Download
Original Article
Antibiofilm activity and mechanisms of Amomum tsao-ko and clove essential oils against Staphylococcus aureus
Guoqing Yu1,2†, Ming Chen1,2†, Zedong Liao3†, Yi wu Wen1,2, Shan Chen1,2, Yixi Zhou1,2, Keshan Lin1,2, Jialin Dai1,2, Min Dai1,2*, Fenghui Sun1,2*
1School of Laboratory Medicine, Chengdu Medical College, Chengdu, China;
2Sichuan Provincial Engineering Laboratory for Prevention and Control Technology of Veterinary Drug Residue in Animal-Origin Food, Chengdu Medical College, Chengdu, China;
3Department of Clinical Laboratory, Guangyuan Central Hospital, Guangyuan, Sichuan, China
†These authors contributed equally to this work and share first authorship
Abstract
Staphylococcus aureus biofilms significantly threaten public health by causing persistent infections and -foodborne diseases. The rise in antibiotic resistance emphasizes the urgent need for effective non-antibiotic control strategies. This study evaluated the anti-biofilm potential of Amomum tsao-ko (AEO) and clove (CEO) essential oils against S. aureus NCTC8325. Gas chromatography–mass spectroscopy analysis revealed distinct chemical profiles, with AEO exhibiting greater diversity. Both essential oils showed potent anti-biofilm activity against S. aureus NCTC8325, effectively preventing biofilm establishment, as confirmed by confocal laser scanning microscopy and scanning electron microscopy. The growth curves and crystal violet staining results demonstrated that AEO and CEO effectively inhibit biofilm formation at concentrations of 91.3 μg/mL and 86.3 μg/mL, respectively, without affecting bacterial growth. Transcriptomic profiling revealed that both AEO and CEO exert anti-biofilm effects through significant regulation of multiple molecular pathways. Interestingly, although the specific pathways influenced by AEO and CEO differed, both treatments significantly downregulated the S. aureus infection pathway and the expression of key adhesin protein genes within this pathway. Overall, this study provides critical insights into the phenotypic and transcriptional responses of S. aureus to AEO and CEO, thereby elucidating the molecular basis of their anti-biofilm activities.
Key words: Staphylococcus aureus, biofilm, Amomum tsao-ko oil, clove oil
*Corresponding Authors: Fenghui Sun and Min Dai, School of Laboratory Medicine, Chengdu Medical College, Chengdu 610500, China. Emails: [email protected]; [email protected]
Academic Editor: Carlos A.F. Oliveira, PhD, Department of Food Engineering, School of Animal Science and Food Engineering, University of São Paulo, Brazil
Received: 3 June 2025; Accepted: 16 December 2025; Published: 20 March 2026
© 2026 Codon Publications
This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY-NC-SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/)
Introduction
Staphylococcus aureus is a major pathogen -responsible for a wide range of invasive infections in humans, including skin and soft tissue infections, endocarditis, pneumonia, and septicemia as well as severe -foodborne illnesses (Chung and Huh, 2015; Hatlen and Miller, 2021; Tong et al., 2015). Moreover, the ability of S. aureus to form biofilms markedly enhances its tolerance to antimicrobial agents, facilitating chronic and recurrent infections that are often difficult to eradicate (Hernández-Cuellar et al., 2023; Mahmoudi et al., 2019; Piechota et al., 2018). In implant-associated infections, S. aureus biofilms often colonize medical devices, such as joint replacements, heart valves, and urinary catheters, thus increasing the risk of complications and the likelihood of reoperation (Klinger-Strobel et al., 2017; Rahimi et al., 2016; Swearingen et al., 2016). In chronic wound infections, including diabetic foot ulcers and pressure sores, the presence of S. aureus biofilms delays wound healing and predispose patients to recurrent or persistent infections. Moreover, S. aureus biofilms that develop on food-processing surfaces contribute to foodborne outbreaks, posing significant challenges to food safety and infection control (Cascioferro et al., 2021; Silva et al., 2021; Vergara et al., 2017).
Biofilms are highly organized microbial consortia composed of extracellular DNA, lipids, proteins, and polysaccharides that adhere to both biotic and abiotic surfaces. They serve as protective barriers that shield bacterial cells from environmental stresses, such as ultraviolet (UV) radiation, extreme temperature or pH, high salinity, nutrient deprivation, and exposure to antibiotics or disinfectants (Yin et al., 2019). Compared to their planktonic counterparts, biofilm-embedded bacteria display markedly enhanced resistance to antimicrobial treatments, complicating eradication efforts and contributing to persistent implant-associated infections (Reis et al., 2020) and recurrent foodborne diseases (Guo et al., 2023). Given the high resistance of biofilms to conventional antibiotics, the development of safe and effective alternative strategies to mitigate biofilm-associated health risks has become an urgent global priority (Rather et al., 2021). Current biofilm management strategies encompass diverse approaches, including anti-biofilm peptides (e.g., LL-37) (Ridyard et al., 2021), bacteriophage therapy (Pires et al., 2022), electromagnetic interventions, antibacterial coatings (Arciola et al., 2018; Khatoon et al., 2018), and treatments based on natural products.
Among these, plant-derived essential oils have gained considerable attention due to their low toxicity, safety, biodegradability, and environmental compatibility, making them promising candidates for controlling biofilm-associated infections and for using in food preservation (Li et al., 2022b; Melander et al., 2020). Essential oils extracted from diverse plant sources, such as Cinnamomum verum (Yanakiev et al., 2020), Artemisia dracunculus (Mohammadi Pelarti et al., 2021), Leptospermum scoparium (Pedonese et al., 2022), Thymbra capitata (Almeida et al., 2022), Salvia fruticosa, and Origanum vulgare (Ersanli et al., 2023), have demonstrated strong anti-biofilm and biofilm-dispersing activity, highlighting their therapeutic potential against S. aureus biofilm-associated infections. Among these natural products, Amomum tsao-ko essential oil (AEO) and clove essential oil (CEO) exhibit a wide range of biological activities, including antioxidant (Xie et al., 2022), anti-Trichomonas vaginalis (Dai et al., 2016a), antitumor (Zhang et al., 2015), anti-inflammatory (Kim et al., 2016), and antiviral effects (Liñán-Atero et al., 2024). AEO and CEO have shown significant antibacterial activity against S. aureus (Li et al., 2022a; Min et al., 2016; Yan et al., 2025). However, the molecular mechanisms underlying their inhibitory effects on S. aureus biofilm formation remain poorly understood, and it is unclear whether these essential oils act through shared or distinct regulatory pathways.
In the present study, we conducted a comprehensive comparative analysis of AEO and CEO to elucidate their anti-biofilm mechanisms against S. aureus. The investigation included chemical composition profiling of each essential oil, antimicrobial assays, biofilm formation and disruption assays (crystal violet [CV] staining), ultrastructural characterization by microscopy, and transcriptomic sequencing integrated with molecular validation. Through this multifaceted approach, we systematically examined the inhibitory concentrations, anti-biofilm efficacy, affected molecular pathways, and key regulatory genes involved in the actions of AEO and CEO, providing new insights into their mechanisms of biofilm suppression.
Materials and Methods
Source and preparation of essential oils and S. aureus strain
Amomum tsao-ko was purchased from Beijing Tongren Drug Store (China). The dried fruits were crunched, and the essential oil was extracted as per the protocols described by Dai et al. (2016b). The extracted oil was stored at 4°C for further use. The CEO was purchased from Shanghai Yuan Ye Biotechnology Co. Ltd. (catalog number: 8000–34–8; China). S. aureus NCTC8325 was obtained from the National Collection of Type Cultures and preserved at –80°C in laboratory. Before experimentation, the bacterial strain was first cultured on nutrient agar (Aoboxing, Beijing, China) at 37°C for 24 h, and single colonies were subsequently inoculated into nutrient broth and incubated at 37°C with continuous shaking at 200 rpm for 24 h.
Characterization of AEO and CEO chemical composition using gas chromatography–mass spectrometry (GC-MS)
The chemical compositions of AEO and CEO were -analyzed by GC–MS on the Agilent Technologies 7890B GC system coupled with a 5977B inert mass selective detector (MSD) and controlled via the Agilent ChemStation software (Agilent Technologies Co. Ltd., Santa Clara, CA, USA). AEO analysis was performed on an Agilent 19091S-433 column (30 m × 0.25 mm × 0.25 μm). Samples (1 µL) were injected by using an Agilent G4513A autosampler in split mode at a ratio of 20:1, with helium acting as a carrier gas at a flow rate of 1.0 mL/min. The GC oven was programmed as follows: initial temperature 60°C held for 5 min, ramped to 110°C at 1°C/min, and held for 5 min, increased to 180°C at 5°C/min and held for 3 min, and finally heated to 240°C at 3°C/min and held for 5 min. Mass spectrometer operated in electron impact (EI) mode with a scan range of 50–800 amu, an ionization energy of 70 eV, and ion source and quadrupole temperatures set at 240°C and 150°C, respectively. CEO analysis followed a similar protocol, with a modified oven program: initial temperature 40°C held for 30 min, then ramped to 220°C at 5°C/min and held for 30 min. Compound identification was achieved by comparing the obtained mass spectra with reference spectra in the NIST 17.L library (National Institute of Standards and Technology, USA; https://webbook.nist.gov), and the relative component abundances were calculated from peak areas using the Mass Hunter B.07.00 software.
Analysis of bacterial growth in the presence of AEO and CEO
A single colony of S. aureus was inoculated into Mueller–Hinton broth (MHB; Solarbio, Beijing, China) and cultured overnight. The resulting bacterial suspension was adjusted to an optical density at 600 nm (OD600) of 0.6 and diluted 1:100 in fresh MHB. The aliquots were then added to MHB containing either AEO (final concentrations: 11.4, 22.8, 45.6, 91.3, 182.5, 365, and 730 μg/mL) or CEO (final concentrations: 10.8, 21.5, 43.1, 86.3, 172.5, 345, and 690 μg/mL). The control did not contain any essential oil. The bacterial growth was monitored by measuring OD600 at intervals of over 24 h using a microplate reader (BioTek, Winooski, VT, USA). All experiments were conducted in triplicate.
Assessment of antibacterial activity of AEO and CEO by MIC and MBC assays
The minimum inhibitory concentration (MIC) of AEO and CEO against S. aureus NCTC8325 was determined using 96-well microtiter plates in accordance with the guidelines of the Clinical and Laboratory Standards Institute (CLSI). Briefly, 100 µL of bacterial suspension adjusted to 1.5 × 106 CFU/mL in MHB (Solarbio) was added to each well, along with serial dilutions of AEO (0–1,380 μg/mL) or CEO (0–1,460 μg/mL) prepared in MHB. The plates were incubated at 37°C for 18 h, and the lowest concentration of essential oils with no visible growth of microorganisms was defined as MIC. To determine minimum bactericidal concentration (MBC), 10 µL of culture from the wells showing no visible growth was plated onto Mueller–Hinton agar (MHA; Solarbio) and incubated at 37°C for 24 h. The MBC was defined as the lowest concentration at which no bacterial colonies were observed. All experiments were performed in triplicate.
Evaluation of anti-biofilm activity of AEO and CEO via CV assay
The inhibitory effects of AEO and CEO on biofilm formation were assessed by using the CV staining method as described by Ersanli et al. (2023). Briefly, exponential-phase S. aureus cells (100 µL, 0.5 McFarland) were added to a 96-well microtiter plate containing 100 µL of tryptic soy broth (TSB; Solarbio) supplemented with 1% glucose and sub-inhibitory concentrations of AEO or CEO. After incubation at 37°C for 24 h, the planktonic cells were removed, and the wells were gently rinsed thrice with phosphate-buffered saline (PBS). The biofilms were stained with 1% CV for 20 min at room temperature, followed by three washes with PBS, air drying, and solubilization in 95% ethanol. The absorbance was measured at 570 nm by using a microplate reader. Wells without essential oil treatment served as controls. The minimum biofilm inhibitory concentration (MBIC) was defined as the lowest concentration of AEO or CEO at which OD600 displayed no significant difference when compared to the TSB blank control. The biofilm inhibition rate (%) was -calculated as follows:
Biofilm inhibition rate (%) = ([ODcontrol – ODinhibition] ÷ ODcontrol) × 100%.
The disruptive effects of AEO and CEO on mature biofilms were evaluated similarly. Exponential-phase S. aureus cells (100 µL) were first cultured in a 96-well microtiter plate containing 100 µL of TSB with 1% glucose and incubated at 37°C for 24 h to allow formation of biofilm. The preformed biofilms were then treated with varying concentrations of AEO (91.3–2,920 μg/mL) or CEO (86.3–2760 μg/mL) at 37°C for 24 h. After treatment, the essential oils were removed, and the biofilms were stained and solubilized as described earlier. Absorbance at 570 nm was measured to assess biofilm disruption. Wells treated with sterile TSB served as blank control. The minimum biofilm eradication concentration (MBEC) was defined as the lowest concentration of essential oils that shows no significant difference in values compared to the TSB blank control. The biofilm elimination rate (%) was calculated as follows:
Biofilm elimination rate (%) = ([ODcontrol - ODdisruption] ÷ ODcontrol) × 100%.
All experiments were performed in triplicate.
Microscopic examination of S. aureus biofilms following AEO and CEO treatment
For confocal laser scanning microscopy (CLSM) analysis, S. aureus biofilms were treated with AEO (365 μg/mL) or CEO (345 μg/mL) in 8-well chamber slides (Nunc Lab-Tek; Thermo Fisher Scientific, MA, USA) with 400 µL per well. Following incubation at 37°C for 24 h, the biofilms were gently rinsed thrice with sterile PBS, air-dried at room temperature for 20 min, fixed with 5% formaldehyde for 5 min, rehydrated with 95% ethanol for 5 min, and stained with 0.1% (w/v) acridine orange solution for 15 min in the dark. The control samples were processed identically in the absence of essential oils. The biofilm images were acquired at 488 nm using a CLSM (A1R MP+; Nikon Ltd., Japan).
For scanning electron microscopy (SEM) analysis, S. aureus biofilms were formed on glass slides in 8-well chamber slides (400 µL/well) in the presence of AEO (365 μg/mL) or CEO (345 μg/mL). After incubation at 37°C for 24 h, the slides were washed with PBS, fixed with 5% formaldehyde for 5 min, and dehydrated through a graded ethanol series (50%, 70%, 90%, and 100%) for 2 min each. The morphological changes in bacterial cells following essential oil treatment were observed by SEM (Helios G4 UC type, Aztec Live ULTIM; Thermo Fisher).
Quantification of extracellular proteins and polysaccharides and viable cell counts in biofilms
The extracellular proteins content was determined by using a previously reported method with minor modifications (Gao et al., 2022). Log-phase S. aureus cells were diluted as 1:100 in fresh TSB supplemented with 0.5% (w/v) glucose and exposed to varying concentrations of AEO (45.6, 91.3, and 182.5 μg/mL) or CEO (43.1, 86.3, and 172.5 μg/mL) for 24 h to allow the formation of mature biofilms. Untreated S. aureus cells served as controls. Following the incubation, the samples were washed and resuspended in PBS. Extracellular proteins were isolated via centrifugation and quantified using a bicinchoninic acid (BCA) protein assay kit (Solarbio) in accordance with the manufacturer’s instructions.
The extracellular polysaccharides content was determined by using a previously reported method albeit with minor modifications (Liu et al., 2017). Briefly, 2 mL of the sample was mixed with 1 mL of 6% (w/v) phenol solution, followed by the rapid addition of 5 mL of concentrated sulfuric acid. The reaction mixture was incubated in a water bath at 90°C for 15 min and then cooled to room temperature. The absorbance of the mixture was measured at 490 nm using a UV-visible spectrophotometer.
Biofilm viability was assessed by using a method as described previously with minor modifications (Qian et al., 2020). Briefly, after 24-h treatment with AEO or CEO in a 6-well plate, the matured biofilms were disrupted in an ultrasonic water bath. The resulting suspensions were washed thrice with 200 μL of 10-mM PBS and serially diluted in 10-fold increments with PBS. Aliquots of 10 μL from each dilution were plated onto tryptic soy agar (TSA) and incubated at 37°C for 24 h. Bacterial viability was determined by enumerating the colony--forming units (CFUs).
RNA extraction, sequencing, and quantitative reverse transcription–polymerase chain reaction (qRT-PCR) validation
A total of nine samples were used for RNA-seq analysis, which comprised three biological replicates per group. S. aureus strain NCTC8325 was cultured in TSB medium with or without AEO (91.3 μg/mL) or CEO (86.3 μg/mL) at 37°C for 24 h. Total RNA was extracted following the manufacturer’s protocol using the RNAprep Pure Cell/Bacteria kit (TIANGEN Biotech, Beijing, China). The RNA samples were then submitted to Shanghai Meiji Biotechnology Co. Ltd. for sequencing.
The resulting clean reads were aligned to the S. aureus subsp. aureus reference genome (GenBank accession GCA_000013425.1) using HISAT2 (v2.1.0) (Kim et al., 2019). Differentially expressed genes (DEGs) between the AEO and CEO treatment groups and the control group were identified using the DESeq2 package (v1.38.3) (Quinn et al., 2018) in R software with a fold change of ≥1.5 and a significance threshold (P < 0.05). To investigate biological functions and pathways associated with DEGs, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were performed using the R package clusterProfiler, with a focusing on terms with P < 0.05. The Raw sequence data reported in this paper were deposited in the Genome Sequence Archive in National Genomics Data Center, China National Center for Bioinformation/Beijing Institute of Genomics, Chinese Academy of Sciences (Project Number: PRJCA050085), which are publicly accessible at https://ngdc.cncb.ac.cn/gsa.
To validate RNA-seq results, qRT-PCR was performed. The RNA samples were prepared as described above. Total RNA was reverse-transcribed into complementary DNA (cDNA) by using PrimeScript™ FAST RT Reagent Kit with genomic DNA (gDNA) eraser (Takara, Japan). qRT-PCR reactions were conducted using the TB Green® Premix Ex Taq™ II FAST qPCR kit (Takara) on a CFX Connect real-time PCR system (Bio-Rad Laboratories, Hercules, CA, USA), following the manufacturer’s instructions. Primers were designed using the Primer 5.0 software (PREMIER Biosoft, Canada), which are listed in Supplementary Table S1. The gene expressions were normalized to the triosephosphate isomerase (TPI) of S. aureus, and the relative expression of target genes was calculated by using the two-delta-delta-C-T (2-ΔΔCT) method.
Statistical analysis
Data were presented as mean ± standard deviation (SD). All statistical analyses were conducted utilizing GraphPad Prism 9.0. The data were analyzed using one-way analysis of variance (ANOVA), where P < 0.05 was considered to indicate statistical significance. Every experiment was repeated thrice.
Results
Chemical composition and comparison of AEO and CEO
The GC-MS analysis revealed distinct chemical profiles for CEO and AEO (Figure 1), with the principal constituents summarized in Tables 1 and 2. In AEO, 12 major components (relative abundance > 1.0%) were identified, including eucalyptol (30.58%), geraniol (13.10%), citral (7.19%), α-phellandrene (4.22%), 2,6-octadien-1-ol, 3,7-dimethyl-, acetate, (Z)- (2.95%), α-terpinyl formate (2.75%), β-methyl-cinnamaldehyde (2.32%), bicyclo[3.1.1]heptane, 6,6-dimethyl-2-methylene-, (1S)- (1.90%), (E)-2-octenal (1.79%), (1R)-2,6,6-trimethylbicyclo[3.1.1]hept-2-ene (1.61%), 1H-indene-4-carboxaldehyde, 2,3-dihydro (1.53%), and 2-dodecenal (1.18%). In contrast, the CEO was dominated by four major constituents (relative abundance > 1.0%): eugenol (76.35%), caryophyllene (9.69%), humulene (2.39%), and cyclohexane, 1,3,5-triphenyl- (1.24%).
Figure 1. The gas chromatography-mass spectrometer analysis of AEO (A) and CEO (B).
Table 1. The components of AEO identified by GC-MS.
| No. | Compound name | Molecular formula | Relative content/% | Retention time (min) |
|---|---|---|---|---|
| 1 | 2-n-Butyl furan | C8H12O | 0.041 | 5.329 |
| 2 | Heptanal | C7H14O | 0.165 | 5.637 |
| 3 | Bicyclo[3.1.0]hex-2-ene, 4-methyl-1-(1-methylethyl)- | C10H16 | 0.1 | 6.582 |
| 4 | (1R)-2,6,6-Trimethylbicyclo[3.1.1]hept-2-ene | C10H16 | 1.614 | 6.862 |
| 5 | Camphene | C10H16 | 0.05 | 7.475 |
| 6 | Bicyclo[3.1.0]hexane, 4-methylene-1-(1-methylethyl)- | C10H16 | 0.067 | 8.698 |
| 7 | Bicyclo[3.1.1]heptane, 6,6-dimethyl-2-methylene-, (1S)- | C10H16 | 1.901 | 8.841 |
| 8 | 6-methyl-5-Hepten-2-one | C8H14O | 1.154 | 9.504 |
| 9 | β-Myrcene | C10H16 | 0.322 | 9.71 |
| 11 | α-Phellandrene | C10H16 | 4.219 | 10.465 |
| 12 | 3-Carene | C10H16 | 0.138 | 10.746 |
| 13 | 1-methyl-4-(1-methylethyl)-1,3-Cyclohexadiene | C10H16 | 0.183 | 11.173 |
| 14 | p-Cymene | C10H14 | 1.742 | 11.682 |
| 15 | 1,3,5-Cycloheptatriene, 3,7,7-trimethyl- | C10H14 | 1.035 | 11.939 |
| 16 | Eucalyptol | C10H18O | 30.575 | 12.509 |
| 17 | trans-β-Ocimene | C10H16 | 0.082 | 12.833 |
| 18 | (Z)-3,7-dimethyl-1,3,6-Octatriene, | C10H16 | 0.361 | 13.52 |
| 19 | (E)-2-Octenal | C8H14O | 1.791 | 14.288 |
| 20 | p-Cresol | C7H8O | 0.044 | 14.803 |
| 21 | Cyclooctyl alcohol | C8H16O | 1.088 | 15.187 |
| 22 | 1-Octanol | C8H18O | 0.117 | 15.393 |
| 23 | Cyclohexene, 1-methyl-4-(1-methylethylidene)- | C10H16 | 0.212 | 16.468 |
| 24 | Phenol, 2-methoxy- | C7H8O2 | 1.066 | 16.661 |
| 25 | 3-Methyl-2-(2-methyl-2-butenyl)-furan | C10H14O | 0.082 | 17.455 |
| 26 | Linalool | C10H18O | 0.765 | 17.793 |
| 27 | 2-Nonanol | C9H20O | 1.024 | 17.941 |
| 28 | Nonanal | C9H18O | 0.075 | 18.102 |
| 29 | Fenchol | C10H18O | 1.031 | 18.613 |
| 30 | γ-Terpinene | C10H16 | 0.07 | 19.354 |
| 31 | 6-Octenal, 3,7-dimethyl-, (R)- | C10H18O | 1.029 | 22.711 |
| 32 | Phenol, 2,5-dimethyl- | C8H10O | 0.028 | 23.32 |
| 33 | endo-Borneol | C10H18O | 1.093 | 23.545 |
| 34 | Terpinen-4-ol | C10H18O | 0.907 | 24.816 |
| 35 | α-TERPINYL FORMATE | C11H18O2 | 2.75 | 26.49 |
| 36 | Decanal | C10H20O | 0.147 | 28.304 |
| 37 | Neral | C10H16O | 3.83 | 32.304 |
| 38 | 2-Cyclohexen-1-one, 2-methyl-5-(1-methylethyl)-, (S)- | C10H16O | 1.048 | 32.474 |
| 39 | Geraniol | C10H18O | 13.098 | 34.957 |
| 40 | Citral | C10H16O | 7.193 | 36.354 |
| 41 | (1S-endo)Bicyclo[2.2.1]heptan-2-ol, 1,7,7-trimethyl-, acetate | C12H20O2 | 1.042 | 37.058 |
| 42 | Phenol, 2-methyl-5-(1-methylethyl)- | C10H14O | 0.213 | 40.028 |
| 43 | 1H-Indene-4-carboxaldehyde, 2,3-dihydro | C10H10O | 1.527 | 42.44 |
| 44 | 2-Oxabicyclo[2.2.2]octan-6-ol, 1,3,3-trimethyl-, acetate | C12H20O3 | 1.064 | 43.609 |
| 45 | 2,6-Octadiene, 2,6-dimethyl- | C10H18 | 0.041 | 45.594 |
| 46 | β-methyl-Cinnamaldehyde | C10H10O | 2.32 | 46.181 |
| 47 | 2,6-Octadien-1-ol, 3,7-dimethyl-, acetate, (Z)- | C12H20O2 | 2.95 | 49.379 |
| 48 | (E)-2-Decenyl acetate | C12H22O2 | 0.484 | 52.299 |
| 49 | (1R,9R,E)-4,11,11-Trimethyl-8-methylenebicyclo[7.2.0]undec-4-ene | C15H24 | 1.046 | 56.152 |
| 50 | 2-Dodecenal | C12H22O | 1.181 | 58.616 |
| 51 | Z-2-Dodecenol | C12H24O | 0.198 | 59.642 |
| 52 | [3aS-(3aα,3bβ,4β,7α,7aS*)]-octahydro-7-methyl-3-methylene-4-(1-methylethyl)-1H-Cyclopenta[1,3]cyclopropa[1,2]benzene | C15H24 | 0.033 | 60.188 |
| 53 | α-Muurolene | C15H24 | 1.057 | 61.813 |
| 54 | Naphthalene, 1,2,3,5,6,8a-hexahydro-4,7-dimethyl-1-(1-methylethyl)-, (1S-cis) | C15H24 | 0.199 | 63.832 |
| 55 | Cubenene | C15H24 | 1.023 | 64.28 |
| 56 | Cyclohexanemethanol-4-Ethenyl-α,α,4-trimethyl-3-(1-methylethenyl) | C15H26O | 0.183 | 65.56 |
| 57 | Guaiol | C15H26O | 0.015 | 67.979 |
| 58 | 1,5-Dodecadiene | C12H22 | 1.138 | 68.841 |
| 59 | Naphthalene, 1,2,3,4,4a,7-hexahydro-1,6-dimethyl-4-(1-methylethyl)- | C15H24 | 0.094 | 69.165 |
| 60 | 2-Naphthalenemethanol, 1,2,3,4,4a,5,6,7-octahydro-α,α,4a,8-tetramethyl-, (2R-cis)- | C15H26O | 0.123 | 69.295 |
| 61 | Naphthalene, 1,2,3,5,6,7,8,8a-octahydro-1,8a-dimethyl-7-(1-methylethenyl)-, [1R-(1α,7β,8aα)]- | C15H24 | 1.011 | 69.56 |
| 62 | Bicyclo[4.4.0]dec-1-ene, 2-isopropyl-5-methyl-9-methylene- | C15H24 | 0.07 | 69.703 |
| 63 | 2-Naphthalenemethanol, decahydro-α,α,4a-trimethyl-8-methylene-[2R-(2α,4a.α,8αβ)] | C15H26O | 0.215 | 69.926 |
| 64 | β-Panasinsene | C15H24 | 0.195 | 70.053 |
| 65 | tau-Cadinol | C15H26O | 0.123 | 70.176 |
| 66 | Naphthalene, 1,2,3,5,6,7,8,8a-octahydro-1,8a-dimethyl-7-(1-methylethenyl)-, [1S-(1α,7α,8aα)]- | C15H24 | 0.136 | 70.62 |
| 67 | 9H-Fluoren-9-one | C13H8O | 0.014 | 72.417 |
| 68 | (E)-β-Famesene | C15H24 | 0.026 | 72.519 |
| 69 | (E)-3-Butylidene-4,5-dihydroisobenzofuran-1(3H)-one | C12H14O2 | 0.111 | 72.707 |
| 70 | Phenanthrene | C14H10 | 0.023 | 73.566 |
Based on structural classification, these components were grouped into six categories: aromatics, alcohols, aldehydes, alkenes, monoterpenes, and others. Comparative profiling revealed notable compositional differences between two essential oils: AEO exhibited greater chemical diversity, characterized by higher proportions of alcohols, aldehydes, and miscellaneous compounds, whereas aromatics predominated CEO (Figure 2). Given the compositional differences and the observed similar anti-biofilm activity of AEO and CEO against S. aureus, we further investigated their potential mechanisms of action.
Figure 2. Comparison of components in the AEO and CEO compound categories.
Antibacterial and anti-biofilm effects of AEO and CEO against S. aureus
The antibacterial activities of AEO and CEO were evaluated by determining their MIC, MBC, and growth curves. As shown in Figures 3A and 3B, both essential oils markedly inhibited S. aureus growth in a -concentration-dependent manner, as reflected by decreasing OD at 600 nm (OD600). Notably, significant reductions in OD at 600 nm were observed at concentrations of 730 μg/mL for AEO and 690 μg/mL for CEO. MIC determination yielded comparable antibacterial potencies, 730 μg/mL for AEO and 690 μg/mL for CEO, consistent with cell density data (Supplementary Figure S1). MBC values were substantially higher than their respective MICs, indicating that bactericidal activity required higher concentrations than those needed for growth inhibition. Specifically, MBC for AEO was 1.45 mg/mL (approximately twice its MIC), while that for CEO was 2.76 mg/mL (approximately four-fold its MIC). Collectively, these results indicate that both AEO and CEO can suppress S. aureus proliferation, although their bactericidal thresholds differ.
Figure 3. Effects of AEO (A) and CEO (B) at different concentrations on the activity of S. aureus NCTC8325 assessed by the growth curve assay. Effect of AEO (C and E) and CEO (D and F) with sub-minimum inhibitory concentrations on the formation of S. aureus biofilms assessed by crystal violet staining. ***P < 0.001, ****P < 0.0001 compared with the control group.
The anti-biofilm potential of AEO and CEO was subsequently assessed across a concentration gradient (Figures 3C and 3D). AEO and CEO significantly inhibited biofilm formation induced by S. aureus. At 91.3 μg/mL, AEO reduced biofilm biomass by 37.693% ± 5.214%, whereas CEO achieved a 39.774% ± 5.404% reduction at 86.3 μg/mL (Figures 3E and 3F). The MICs of biofilm, determined through CV staining, were 730 μg/mL for AEO and 690 μg/mL for CEO, aligning with their MIC values. These results indicated that the sub-MIC values of AEO (11.4, 22.8, 45.6, 91.3, 182.5, and 365 μg/mL) and CEO (10.8, 21.5, 43.1, 86.3, 172.5, and 345 μg/mL) significantly inhibited S. aureus NCTC8325 biofilm formation in a dose-dependent manner.
Disruption of S. aureus biofilms by AEO and CEO
The ability of AEO and CEO to disrupt pre-established S. aureus biofilms was also examined (Figure 4). Biofilm disruption increased progressively with increasing concentrations of both essential oils, with nearly complete biofilm eradication observed at 2,900 μg/mL for AEO and 1,380 μg/mL for CEO. Accordingly, the minimum biofilm eradication concentrations were determined to be 2,900 μg/mL for AEO and 1,380 μg/mL for CEO (Table 3).
Figure 4. The eradication effect of different concentrations of AEO (A) and CEO (B) on preformed biofilm formation of S. aureus NCTC8325, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 compared with the 0 μg/ml group.
Table 2. The components of CEO identified by GC-MS.
| No. | Compound name | Molecular formula | Relative content/% | Retention time (min) |
|---|---|---|---|---|
| 1 | Phenol, 4-(2-propenyl)- | C9H10O | 0.16 | 19.392 |
| 2 | Eugenol | C10H12O2 | 76.348 | 22.234 |
| 3 | Copaene | C15H24 | 0.244 | 22.523 |
| 4 | (-)-Tricyclo[6.2.1.0(4,11)]undec-5-ene, 1,5,9,9-tetramethyl- (isocaryophyllene-I1) | C15H24 | 0.225 | 22.722 |
| 5 | Naphthalene, 1,2,4a,5,8,8a-hexahydro-4,7-dimethyl-1-(1-methylethyl)-, (1α,4a.β,8a.α)-(+/-)- | C15H24 | 0.239 | 22.834 |
| 6 | 1H-Cyclopropa[a]naphthalene, decahydro-1, 1,3a-trimethyl-7-methylene-, [1aS-(1a.α,3a.α,7a.β,7b.α)] | C15H24 | 1.094 | 22.898 |
| 7 | Bicyclo[7.2.0]undec-4-ene, 4,11,11-trimethyl-8-methylene-,[1R-(1R*,4Z,9S*)]- | C15H24 | 0.151 | 23.333 |
| 8 | 2,10,10-Trimethyltricyclo[7.1.1.0(2,7)]undec-6-en-8-one | C14H20O | 0.169 | 23.381 |
| 9 | 1S,2S,5R-1,4,4-Trimethyltricyclo[6.3.1.0(2,5)]dodec-8(9)-ene | C15H24 | 1.163 | 23.489 |
| 10 | Caryophyllene | C15H24 | 9.692 | 23.678 |
| 11 | Tricyclo[4.1.0.0(2,4)]heptane, 3,3,7,7-tetramethyl-5-(2-methyl-1-propenyl)- | C15H24 | 1.055 | 23.872 |
| 12 | (2S,4aR,8aR)-4a,8-Dimethyl-2-(prop-1-en-2-yl)-1,2,3,4,4a,5,6,8a-octahydronaphthalene | C15H24 | 0.164 | 23.931 |
| 13 | γ-Muurolene | C15H24 | 0.168 | 24.163 |
| 14 | (+)-epi-Bicyclosesquiphellandrene | C15H24 | 0.108 | 24.253 |
| 15 | 4,11,11-trimethyl-8-methylenebicyclo[7.2.0]undec-3-ene | C15H24 | 1.104 | 24.4 |
| 16 | Humulene | C15H24 | 2.388 | 24.514 |
| 17 | Naphthalene, 1,2,4a,5,8,8a-hexahydro-4, 7-dimethyl-1-(1-methylethyl)-, (1α,4a.β,8a.α)-(+/-)- | C15H24 | 1.149 | 24.929 |
| 18 | 1-Isopropyl-4,7-dimethyl-1,2,3,4,5,6-hexahydronaphthalene | C15H24 | 0.162 | 24.987 |
| 19 | α-Muurolene | C15H24 | 0.171 | 25.631 |
| 20 | Naphthalene, 1,2,3,4,4a,7-hexahydro-1,6-dimethyl-4-(1-methylethyl)- | C15H24 | 1.043 | 26.406 |
| 21 | Caryophyllenyl alcohol | C15H26O | 0.817 | 27.353 |
| 22 | 4,4’-(Hexafluoroisopropylidene)diphenol | C15H10F6O2 | 0.284 | 37.505 |
| 23 | Cyclohexane, 1,3,5-triphenyl- | C24H24 | 1.236 | 44.535 |
| 24 | cis-Calamenene | C15H22 | 0.67 | 26.192 |
Table 3. Comparison of the eradication rates of AEO and CEO on preformed biofilms.
| Types of essential oils | Concentrations (μg/ml) | Eradication rate (%) |
|---|---|---|
| Amomum tsao-ko essential oil | 0 | 0 |
| 91.3 | 18.27 ± 12.39 | |
| 182.5 | 46.16 ± 3.16 | |
| 365 | 47.76 ± 5.39 | |
| 730 | 76.37 ± 2.53 | |
| 1460 | 89.15 ± 1.08 | |
| 2920 | 99.92 ± 0.08 | |
| Clove essential oil | 0 | 0 |
| 86.3 | 10.54 ± 1.31 | |
| 172.5 | 14.66 ± 3.35 | |
| 345 | 17.81 ± 7.15 | |
| 690 | 84.25 ± 0.16 | |
| 1380 | 99.91 ± 0.03 | |
| 2760 | 99.96 ± 0.02 |
Confocal laser scanning microscopy revealed that S. aureus formed thick, multilayered biofilms with tightly packed, evenly distributed cells in the control group (Figure 5A). Exposure to either AEO (365 μg/mL) or CEO (345 μg/mL) markedly reduced biofilm density, and yielded predominantly monolayered, dispersed bacterial structures (Figures 5B and 5C).
Figure 5. Confocal laser scanning microscopy images of biofilms treated or untreated with AEO and CEO at 400 x -magnification. Scale bar: 50 μm. (A) Untreated S. aureus biofilm morphology. (B) The morphology of biofilm treated with AEO at 365 μg/ml. Scale bar: 50 μm. (C) The morphology of biofilm treated with CEO at 345 μg/ml. Scale bar: 50 μm.
Scanning electron microscopy observations were consistent with the CLSM results. Untreated S. aureus cultures formed dense, compact, and well-organized biofilms, with cells forming a continuous, paving-stone-like structure on glass surfaces (Figures 6A and 6B). Treatment with AEO (365 μg/mL) or CEO (345 μg/mL) led to pronounced reductions in cell adhesion and disrupted biofilm integrity, characterized by enlarged intercellular gaps and reticular fractures within the extracellular matrix (Figures 6C–6F).
Figure 6. Scanning electron microscope images of biofilms treated or untreated with AEO and CEO at 1000 x or 5000 x -magnification. (A, B) Untreated S. aureus biofilm morphology. Scale bar: 50 μm, 10 μm. (C, D) The morphology of biofilm treated with CEO at 345 μg/ml. Scale bar: 50 μm, 10 μm. (E, F) The morphology of biofilm treated with AEO at 365 μg/ml. Scale bar: 50 μm, 10 μm.
Effects of AEO and CEO on extracellular matrix components and viable cell counts in S. aureus biofilms
Extracellular proteins and polysaccharides are key structural components of S. aureus biofilms. In this study, the effects of AEO and CEO on the contents of these extracellular polymers as well as on the viable bacterial counts within the biofilms were assessed. As shown in Figure 7, both extracellular polymer levels and viable bacterial counts in the biofilms decreased in a concentration-dependent manner of either essential oil. Neither statistically significant reduction of extracellular polymer content nor viable cell counts was observed at the lower concentrations of 91.3 μg/mL (AEO) and 86.3 μg/mL (CEO). In contrast, at the same concentrations, both essential oils significantly inhibited biofilm formation, as measured by CV assay (Figures 3E and 3F).
Figure 7. Effects of AEO and CEO on the release of extracellular protein andextracellular polysaccharides of S. aureus. (A) Release of extracellular proteins after AEO treatment, (B) Release of extracellular polysaccharide after AEO treatment, (D) Release of extracellular proteins after CEO treatment, (E) Release of extracellular polysaccharide after CEO treatment, and the effects of AEO (C) and CEO (F) on viable bacteria in biofilms. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 compared with the control group.
Transcriptomic responses of S. aureus to AEO and CEO treatment
Correlation heat map analysis revealed tight clustering of biological replicates within the AEO- and CEO-treated and control groups, confirming the stability and reproducibility of the RNA-seq data (Figure 8A).
Figure 8: The biofilms of S. aureus exposed to AEO and CEO exhibited an altered transcriptomic profile. (A) Hierarchical -clustering analysis (heat map) of DEGs in the AEO group, CEO group, and control group. (B) Statistical analysis of up-regulated and down-regulated genes between AEO group and control group, CEO group and control group, and AEO group and control group. (C) KEGG pathways of upregulated DEGs of biofilm in the AEO group. (D) KEGG pathways of downregulated DEGs of biofilm in the AEO group. (E) KEGG pathways of upregulated DEGs of biofilm in the CEO group. (F) KEGG pathways of downregulated DEGs of biofilm in the CEO group. Pathways highlighted in blue are uniquely enriched in this group, while those in red represent shared enriched pathways between both essential oil treatment groups. *P < 0.05, **P < 0.01, ***P < 0.001.
Comparative transcriptomic profiling identified 835 DEGs (427 upregulated and 408 downregulated) in the AEO-treated group and 593 DEGs (329 upregulated and 264 downregulated) in the CEO-treated group, compared to the control (Figure 8B). All DEGs of biofilms after AEO and CEO treatment are listed in Supplementary Tables S2 and S3. KEGG pathway enrichment analysis showed that downregulated DEGs in both groups were significantly enriched in the S. aureus infection pathway, which includes multiple genes associated with adhesion and virulence. This transcriptional pattern provides a molecular correlate to phenotypic findings (Figures 3C and 3D).
In contrast, upregulated DEGs were mainly enriched in pathways related to amino acid metabolism and transport, including cysteine and methionine metabolism, monobactam biosynthesis, lysine biosynthesis, valine, leucine and isoleucine biosynthesis, glycine, serine and threonine metabolism, and ABC transporters. Additionally, treatment-specific enrichment patterns were observed: riboflavin metabolism was uniquely upregulated in AEO-treated samples (Figure 8C), whereas atrazine degradation, beta-Lactam resistance, and phenylalanine, tyrosine, and tryptophan biosynthesis and quorum sensing were exclusive to CEO treatment (Figure 8E). Collectively, KEGG analysis revealed that both AEO and CEO downregulate the S. aureus infection pathway while differentially modulating specific metabolic pathways.
To validate these findings, the expressions of biofilm-related genes (icaB, icaC, agrB, fnbB, and clfB) were further examined. The qRT-PCR results showed trends consistent with the transcriptomic data, confirming the stability and reliability of transcriptome analysis (Supplementary Figure S2).
Discussion
Anti-biofilm potential of plant-derived essential oils
Plant-derived natural extracts possess diverse bioactive compounds with significant antimicrobial potential (Aziz et al., 2018). Among them, AEO and CEO effectively inhibit the growth and biofilm formation of multiple pathogenic bacteria (Elbestawy et al., 2023; Lee et al., 2022; Li et al., 2022b; Rahman et al., 2017; Somrani et al., 2022). These properties make them attractive candidates for applications in food packaging (Vasile et al., 2017) and preservation (He et al., 2024; Valarezo et al., 2025).
Consistent with previous findings, our results demonstrated that both AEO and CEO exert substantial anti-biofilm activity at sub-inhibitory concentrations, indicating that their effects extend beyond direct antibacterial action to include modulation of biofilm -formation pathways. Notably, the biofilm formed by S. aureus ATCC43300 was significantly inhibited and eradicated following the treatment with AEO and CEO (Supplementary Figure S3). These results highlighted the potential of plant-derived essential oils as natural, non-antibiotic agents for preventing and controlling biofilm-associated S. aureus contamination in food-related environments.
Biofilm regulatory networks and AEO mechanisms
Transcriptomic analysis revealed significant downregulation of the S. aureus infection pathway following AEO treatment, with the serine-aspartate repeat protein SdrC/D, fibrinogen-binding protein fib, iron-regulated surface determinant protein A of isdA, chemotaxis inhibitory protein of staphylococci chp, and virulence factor hlg genes showing marked downregulation in this pathway. These genes have been demonstrated to be closely associated with biofilm formation (Alabdullatif et al., 2022; Chen et al., 2020, 2022; Sultan et al., 2018). Specifically, SdrC/D, fib, and isdA promote biofilm formation by encoding proteins that facilitate attachment and colonization of S. aureus (Foster et al., 2020; Pant et al., 2022; Roman et al., 2016; Yu et al., 2024a). Hence, the weakened biofilm formation ability following AEO treatment (96.3 μg/mL) could result from the concurrent downregulation of these key adhesion and virulence genes (Figures 3C and 3E).
In addition, AEO treatment significantly upregulated genes involved in amino acid biosynthesis, amino acid metabolism, and riboflavin metabolism. Amino acid and riboflavin homeostasis are known to influence biofilm formation and stability (Böttcher et al., 2022; Mitra et al., 2012). Therefore, these metabolic adjustments may represent a part of the bacterial response to AEO exposure, although their specific role in the observed biofilm inhibition requires further elucidation.
Notably, a previous study proposed that AEO inhibits biofilm formation by regulating biofilm-associated programmed cell death operons and adhesin genes expression (Yan et al., 2025). Discrepancy between our findings and those reports may arise from differences in experimental conditions. In the current study, AEO was applied at a sub-inhibitory concentration (91.3 μg/mL; 1/8 MIC), which does not affect bacterial growth, whereas the previous study employed 0.25 mg/mL, a higher concentration that could trigger distinct stress and regulatory responses.
The CEO interferes with adhesion and quorum-sensing systems
In contrast to AEO, the CEO appears to modulate S. aureus biofilm formation through a distinct yet complementary network of regulatory pathways. Consistent with previous reports (Li et al., 2025), transcriptomic analysis revealed significant enrichment of quorum-sensing pathways following the CEO treatment, a feature absent in the AEO-treated group. This divergence potentially reflects the compositional heterogeneity of plant-derived essential oils, which influences their molecular interactions and mechanisms of action (Neagu et al., 2023). Similar to AEO, exposure to CEO suppressed the S. aureus infection pathway with SdrC/D, staphylococcal protein AspA, fib, chp, and hlp genes showing reduced expression in this pathway. Given the established roles of these factors in adhesion and virulence (Mamdoh et al., 2023), their coordinated downregulation offered a transcriptional-level insight that aligns with the observed inhibition of biofilm formation by CEO (Figures 3D and 3F). Additionally, CEO exposure enriched pathways related to amino acid biosynthesis and metabolism. However, the functional role of these metabolic shifts in regulating S. aureus biofilm dynamics warrants further investigation.
Comparative mechanisms and implications for food industry applications
Most prior studies have focused on the anti-biofilm effects of single essential oils, without accounting for interspecies variations in chemical composition that may alter their molecular targets and efficacy. For instance, agrC was previously identified as a key target gene for CEO (Li et al., 2025). In this study, the same S. aureus strain was used for both CEO- and AEO-related -antimicrobial and anti-biofilm assays, thereby minimizing potential errors arising from strain variability. Through this controlled experimental design, we conducted a systematic and comparative investigation into the mechanisms of CEO and AEO against S. aureus biofilms. Microscopic analyses revealed comparable morphological alterations across treatments, consistent with the observed transcriptomic profiles and pathway enrichment patterns. These findings collectively demonstrated that both essential oils exert inhibitory effects on S. aureus biofilms, converging on specific molecular pathways, including amino acid metabolism and synthesis pathways, riboflavin metabolism pathways, and S. aureus infection pathway.
However, translating these findings into practical applications within the food industry remains challenging. Essential oils are highly sensitive to processing parameters, such as temperature and pH, and their antimicrobial efficacy can be influenced by interactions within complex food matrices. Therefore, developing controlled-release delivery systems, such as nanoemulsions, and assessing their effects on key sensory attributes, including color, flavor, and texture, are essential steps toward practical implementation (Dghais et al., 2023; Mahdi et al., 2023; Yu et al., 2024b). Moreover, conducting in situ or pilot-scale studies under realistic processing conditions will be crucial to validate these approaches and support the integration of essential oils into food safety management frameworks.
Conclusion
At sub-inhibitory concentrations, two structurally distinct essential oils, AEO and CEO, exhibited potent inhibitory effects on S. aureus biofilm formation and integrity. CLSM and SEM imaging confirmed pronounced disruption of biofilm architecture and cell adhesion. Transcriptomic analyses revealed that AEO primarily modulates amino acid biosynthesis, general metabolism, and riboflavin metabolism pathways, while CEO predominantly targets quorum-sensing system and amino acid metabolic processes. Moreover, both oils converge on a shared mechanism involving downregulation of SdrC/D, isdA, spA, fib, chp, and hlp within the S. aureus infection pathway, resulting in impaired bacterial adhesion, virulence, and biofilm establishment. The complementary mechanisms of action not only offer a theoretical foundation for understanding the anti-biofilm efficacy of both essential oils but also provide a scientific basis for developing combined applications or customized strategies for broad-spectrum biofilm control in the food industry.
Mandatory Disclosure on Use of Artificial Intelligence
The authors declare that Al-assisted tools were used as follows: The DeepSeek3.2 had been used to polish the language. All references have been manually verifed for accuracy and relevance.
Data Availability Statement
All data are available in this manuscript.
Author Contributions
Fenghui Sun conceived and designed the project. Guoqing Yu, Ming Chen, and Zedong Liao performed experiment. Shan Chen, Yixi Zhou, Yiwu Wen, and Keshan Lin analyzed the data. Guoqing Yu and Jialin Dai drafted the manuscript. Fenghui Sun and Min Dai modified the manuscript. All authors contributed to the article and approved the submitted version.
Conflict of Interest
The authors declared that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Funding
This study was supported by the National Natural Science Foundation of China (82102442, 32270449, and 82472328), the Sichuan Science and Technology Program (2025YFHZ0215 and 2024YFFK0090), the CMC Excellent-Talent Program (2024yxGzn06), the Open Fund of Development and Regeneration Key Laboratory of Sichuan Province (24LHFYSZ1-36), the Open Fund of Sichuan Provincial Engineering Laboratory for Prevention and Control Technology of Veterinary Drug Residue in Animal-Origin (23LHNBZZD01), the Health Commission of Sichuan Province Medical Science and Technology Program (24WSXT036), and the Sichuan College Students’ Innovation and Entrepreneurship Training Program (S202213705051).
REFERENCES
Alabdullatif, M., and Alzahrani, A. 2022. Expression of biofilm--associated genes in Staphylococcus aureus during storage of platelet concentrates. Transfusion and Apheresis Science 61(6): 103456. 10.1016/j.transci.2022.103456
Almeida, L., Lopes, N., Gaio, V., Cavaleiro, C., Salgueiro, L., Silva, V., Poeta, P., and Cerca, N. 2022. Thymbra capitata essential oil has a significant antimicrobial activity against methicillin-resistant Staphylococcus aureus pre-formed biofilms. Letters in Applied Microbiology 74(5): 787–795. 10.1111/lam.13665
Arciola, C.R., Campoccia, D., and Montanaro, L. 2018. Implant infections: adhesion, biofilm formation and immune evasion. Nature Reviews Microbiology 16(7): 397–409. 10.1038/s41579-018-0019-y
Aziz, Z. A. A., Ahmad, A., Setapar, S.H.M., Karakucuk, A., Azim, M.M., Lokhat, D., Rafatullah, M., Ganash, M., Kamal, M.A. and Ashraf, G.M. 2018. Essential oils: extraction techniques, pharmaceutical and therapeutic potential—a review. Current Drug Metabolism 19(13): 1100–1110. 10.2174/1389200219666180723144850
Böttcher, B., Driesch, D., Krüger, T., Garbe, E., Gerwien, F., Kniemeyer, O., Brakhage, A.A., and Vylkova, S. 2022. Impaired amino acid uptake leads to global metabolic imbalance of Candida albicans biofilms. NPJ Biofilms and Microbiomes 8: 78. 10.1038/s41522-022-00341-9
Cascioferro, S., Carbone, D., Parrino, B., Pecoraro, C., Giovannetti, E., Cirrincione, G., and Diana, P. 2021. Therapeutic strategies to counteract antibiotic resistance in MRSA biofilm-associated infections. ChemMedChem 16(1): 65–80. 10.1002/cmdc.202000677
Chen, J.W., Chen, J.L., Wang, Z.W., Chen, C.C., Zheng, J.X., Yu, Z.J., Deng, Q.W., Zhao, Y.X., and Wen, Z.W. 2022. 20S-ginsenoside Rg3 inhibits the biofilm formation and haemolytic activity of Staphylococcus aureus by inhibiting the SaeR/SaeS two--component system. Journal of Medical Microbiology 71(10): 1587 10.1099/jmm.0.001587
Chen, L., Tang, Z.Y., Cui, S.Y., Ma, Z.B., Deng, H., Kong, W.L., Yang, L.W., Lin, C., Xiong, W.G., and Zeng, Z.L. 2020. Biofilm production ability, virulence and antimicrobial resistance genes in Staphylococcus aureus from various veterinary hospitals. Pathogens (Basel, Switzerland) 9(4): 264. 10.3390/pathogens9040264
Chung, D.R., and Huh, K. 2015. Novel pandemic influenza A (H1N1) and community-associated methicillin-resistant Staphylococcus aureus pneumonia. Expert Review of Anti-Infective Therapy 13(2): 197–207. 10.1586/14787210.2015.999668
Dai, M., Peng, C., Peng, F., Xie, C.B., Wang, P.J., and Sun, F.H. 2016a. Anti-Trichomonas vaginalis properties of the oil of Amomum tsao-ko and its major component, geraniol. Pharmaceutical Biology 54(3): 445–450. 10.3109/13880209.2015.1044617
Dai, M., Peng, C., and Sun, F.H. 2016b. Anti-infectious efficacy of essential oil from Caoguo (Fructus tsaoko). Journal of Traditional Chinese Medicine (Chung I Tsa Chih Ying Wen Pan) 36(6): 799–804. 10.1016/s0254-6272(17)30018-3
Dghais, S., Ben Jemaa, M., Chouchen, M., Jallouli, S., Ksouri, R., and Falleh, H. 2023. Nano-emulsification of cinnamon and curcuma essential oils for the quality improvement of minced meat beef. Foods (Basel, Switzerland) 12(2): 235. 10.3390/foods12020235
Elbestawy, M.K.M., El-Sherbiny, G.M., and Moghannem, S.A. 2023. Antibacterial, antibiofilm and anti-inflammatory activities of eugenol clove essential oil against resistant Helicobacter pylori. Molecules (Basel, Switzerland) 28(6): 2448. 10.3390/molecules28062448
Ersanli, C., Tzora, A., Skoufos, I., Fotou, K., Maloupa, E., Grigoriadou, K., Voidarou, C.C., and Zeugolis, D.I. 2023. The assessment of antimicrobial and anti-biofilm activity of essential oils against Staphylococcus aureus strains. Antibiotics (Basel, Switzerland) 12(2): 384. 10.3390/antibiotics12020384
Foster, C.E., Kok, M., Flores, A.R., Minard, C.G., Luna, R.A., Lamberth, L.B., Kaplan, S.L., and Hulten, K.G. 2020. Adhesin genes and biofilm formation among pediatric Staphylococcus aureus isolates from implant-associated infections. PloS One 15(6): e0235115. 10.1371/journal.pone.0235115
Gao, K.K., Su, B., Dai, J., Li, P., Wang, R.M., and Yang, X.H. 2022. Anti-biofilm and anti-hemolysis activities of 10-hydroxy-2--decenoic acid against Staphylococcus aureus. Molecules 27(5): 1485. 10.3390/molecules27051485
Guo, N., Bai, X., Shen, Y., and Zhang, T.H., 2023. Target-based screening for natural products against Staphylococcus aureus biofilms. Critical Reviews in Food Science and Nutrition 63(14): 2216–2230. 10.1080/10408398.2021.1972280
Hatlen, T.J., and Miller, L.G., 2021. Staphylococcal skin and soft tissue infections. Infectious Disease Clinics of North America 35(1): 81–105. 10.1016/j.idc.2020.10.003
He, Y.X., Yuan, Y., Gao, Y.Y., Chen, M.H., Li, Y.Y., Zou, Y., Liao, L.K., Li, X.T., Wang, Z., Li, J.H., and Zhou, W. 2024. Enhancement of colorimetric pH-sensitive film incorporating Amomum tsao-ko essential oil as antibacterial for mantis shrimp spoilage tracking and fresh-keeping. Foods (Basel, Switzerland) 13(11): 1638. 10.3390/foods13111638
Hernández-Cuellar, E., Tsuchiya, K., Valle-Ríos, R., and Medina-Contreras, O. 2023. Differences in biofilm formation by-methicillin-resistant and methicillin-susceptible Staphylococcus aureus strains. Diseases 11(4): 160. 10.3390/diseases11040160
Khatoon, Z., McTiernan, C.D., Suuronen, E.J., Mah, T.-F., and Alarcon, E.I. 2018. Bacterial biofilm formation on-implantable devices and approaches to its treatment and prevention. Heliyon 4(12): e01067. 10.1016/j.heliyon.2018.e01067
Kim, M.-S., Ahn, E.-K., Hong, S.S., and Oh, J.S. 2016. 2,8-Decadiene-1,10-diol inhibits lipopolysaccharide-induced inflammatory responses through inactivation of mitogen-activated protein kinase and nuclear factor-κB signaling pathway. Inflammation 39(2): 583–591. 10.1007/s10753-015-0283-1
Kim, D., Paggi, J.M., Park, C., Bennett, C., and Salzberg, S.L. 2019. Graph-based genome alignment and genotyping with HISAT2 and HISAT genotype. Nature Biotechnology 37(8): 907–915. 10.1038/s41587-019-0201-4
Klinger-Strobel, M., Stein, C., Forstner, C., Makarewicz, O., and Pletz, M.W., 2017. Effects of colistin on biofilm matrices of Escherichia coli and Staphylococcus aureus. International Journal of Antimicrobial Agents 49(4): 472–479. 10.1016/j.ijantimicag.2017.01.005
Lee, S.Y., Shetye, G.S., Son, S.-R., Lee, H., Klein, L.L., Yoshihara, J.K., Ma, R., Franzblau, S.G., Cho, S., and Jang, D.S. 2022. Anti-microbial activity of aliphatic alcohols from Chinese black cardamom (Amomum tsao-ko) against Mycobacterium tuberculosis H37Rv. Plants (Basel, Switzerland) 12(1): 34. 10.1016/j.ijantimicag.2017.01.005
Li, H., Li, J., Hua, Z.C., Aziz, T., Khojah, E., Cui, H.Y., and Lin, L. 2025. Transcriptomic combined with molecular dynamics simulation analysis of the inhibitory mechanism of clove essential oil against Staphylococcus aureus biofilm and its application on surface of food contact materials. Food and Bioproducts Processing 150: 131–140. 10.1016/j.fbp.2025.01.009
Li, W.D., Li, J.J., Qin, Z., Wang, Y., Zhao, P.Y., and Gao, H.Y. 2022a. Insights into the composition and antibacterial activity of Amomum tsao-ko essential oils from different regions based on GC-MS and GC-IMS. Foods 11(10): 1402. 10.3390/foods11101402
Li, J., Li, C., Shi, C., Aliakbarlu, J., Cui, H., and Lin, L. 2022b. Antibacterial mechanisms of clove essential oil against Staphylococcus aureus and its application in pork. International Journal of Food Microbiology 380: 109864. 10.1016/j.ijfoodmicro.2022.109864
Liñán-Atero, R., Aghababaei, F., García, S.R., Hasiri, Z., Ziogkas, D., Moreno, A., and Hadidi, M. 2024. Clove essential oil: chemical profile, biological activities, encapsulation strategies, and food applications. Antioxidants (Basel, Switzerland) 13(4): 488. 10.3390/antiox13040488
Liu, M., Wu, X., Li, J., Liu, L., Zhang, R., Shao, D., and Du, X. 2017. The specific anti-biofilm effect of gallic acid on Staphylococcus aureus by regulating the expression of the ica operon. Food Control 73: 613–618. 10.1016/j.foodcont.2016.09.015
Qian, W., Liu, M., Fu, Y., Zhang, J., Liu, W., Li, J., Li, X., Li, Y., and Wang, T. 2020. Antimicrobial mechanism of luteolin against Staphylococcus aureus and Listeria monocytogenes and its antibiofilm properties. Microbial pathogenesis, 142, 104056. 10.1016/j.micpath.2020.104056
Mahdi, A.A., Al-Maqtari, Q.A., Al-Ansi, W., Hu, W., Hashim, S.B.H., Cui, H.Y., and Lin, L. 2023. Replacement of polyethylene oxide by peach gum to produce an active film using Litsea cubeba essential oil and its application in beef. International Journal of Biological Macromolecules 241: 124592. 10.1016/j.ijbiomac.2023.124592
Mahmoudi, H., Pourhajibagher, M., Chiniforush, N., Soltanian, A.R., Alikhani, M.Y., and Bahador, A. 2019. Biofilm formation and antibiotic resistance in meticillin-resistant and meticillin-sensitive Staphylococcus aureus isolated from burns. Journal of Wound Care 28(2): 66–73. 10.12968/jowc.2019.28.2.66
Mamdoh, H., Hassanein, K.M., Eltoony, L.F., Khalifa, W.A., Hamed, E., Alshammari, T.O., Abd El-Kareem, D.M., and El-Mokhtar, M.A. 2023. Clinical and bacteriological analyses of biofilm-forming Staphylococci-isolated from diabetic foot ulcers. Infection and Drug Resistance 16: 1737–1750. 10.2147/IDR.S393724
Melander, R.J., Basak, A.K., and Melander, C. 2020. Natural products as inspiration for the development of bacterial antibiofilm agents. Natural Product Reports 37(11): 1454–1477. 10.1039/d0np00022a
Mitra, S., Thawrani, D., Banerjee, P., Gachhui, R., and Mukherjee, J. 2012. Induced biofilm cultivation enhances riboflavin production by an intertidally derived Candida famata. Applied Biochemistry and Biotechnology 166(8): 1991–2006. 10.1007/s12010-012-9626-7
Mohammadi Pelarti, S., Karimi Zarehshuran, L., Babaeekhou, L. and Ghane, M. 2021. Antibacterial, anti-biofilm and anti-quorum sensing activities of Artemisia dracunculus essential oil (EO): a study against Salmonella enterica serovar Typhimurium and Staphylococcus aureus. Archives of Microbiology 203(4): 1529–1537. 10.1007/s00203-020-02138-w
Neagu, R., Popovici, V., Ionescu, L.E., Ordeanu, V., Popescu, D.M., Ozon, E.A., and Gîrd, C.E. 2023. Antibacterial and antibiofilm effects of different samples of five commercially available essential oils. Antibiotics (Basel, Switzerland) 12(7): 1191. 10.3390/antibiotics12071191
Pant, N., Miranda-Hernandez, S., Rush, C., Warner, J., and Eisen, D.P. 2022. Non-antimicrobial adjuvant therapy using ticagrelor reduced biofilm-related Staphylococcus aureus prosthetic joint infection. Frontiers in Pharmacology 13: 927783. 10.3389/fphar.2022.927783
Pedonese, F., Longo, E., Torracca, B., Najar, B., Fratini, F., and Nuvoloni, R. 2022. Antimicrobial and anti-biofilm activity of manuka essential oil against Listeria monocytogenes and Staphylococcus aureus of food origin. Italian Journal of Food Safety 11(1): 10039. 10.4081/ijfs.2022.10039
Piechota, M., Kot, B., Frankowska-Maciejewska, A., Grużewska, A. and Woźniak-Kosek, A. 2018. Biofilm formation by methicillin-resistant and methicillin-sensitive Staphylococcus aureus strains from hospitalized patients in Poland. BioMed Research International 2018: 4657396. 10.1155/2018/4657396
Pires, D.P., Meneses, L., Brandão, A.C., and Azeredo, J. 2022. An overview of the current state of phage therapy for the treatment of biofilm-related infections. Current Opinion in Virology 53: 101209. 10.1016/j.coviro.2022.101209
Qiu, M., Long, N.N., Gao, M.X., Zhou, Y.Y., Sun, F.H., Lin, L., and Dai, M. 2019. In vitro anti-MRSA effect of clove oil combined with β-lactam antibiotics against methicillin-resistant Staphylococcus aureus. Chinese Herbal Medicines 50(7): 1629–1635. 10.7501/j.issn.0253-2670.2019.07.020
Quinn, T.P., Crowley, T.M., and Richardson, M.F. 2018. Benchmarking differential expression analysis tools for RNA-Seq: normalization-based vs. log-ratio transformation-based methods. BMC Bioinformatics 19(1): 274. 10.1186/s12859-018-2261-8
Rahimi, F., Katouli, M., and Karimi, S. 2016. Biofilm production among methicillin resistant Staphylococcus aureus strains isolated from catheterized patients with urinary tract infection. Microbial Pathogenesis 98: 69–76. 10.1016/j.micpath.2016.06.031
Rahman, M.R.T., Lou, Z., Yu, F., Wang, P., and Wang, H. 2017. Anti-quorum sensing and anti-biofilm activity of Amomum tsaoko (Amommum tsao-ko Crevost et Lemarie) on foodborne pathogens. Saudi Journal of Biological Sciences 24(2): 324–330. 10.1016/j.sjbs.2015.09.034
Rather, M.A., Gupta, K., and Mandal, M. 2021. Microbial biofilm: formation, architecture, antibiotic resistance, and control strategies. Brazilian Journal of Microbiology 52(4): 1701–1718. 10.1007/s42770-021-00624-x
Reis, S.V.D., Couto, N.M., G. de, Brust, F.R., Trentin, D.S., Silva, J.K.R., da, Arruda, M.S.P., Gnoatto, S.C.B., and Macedo, A.J. 2020. Remarkable capacity of Brosimine B to disrupt methicillin--resistant Staphylococcus aureus (MRSA) preformed biofilms. Microbial Pathogenesis 140: 103967. 10.1016/j.micpath.2020.103967
Ridyard, K.E., and Overhage, J. 2021. The potential of human peptide LL-37 as an antimicrobial and anti-biofilm agent. Antibiotics (Basel, Switzerland) 10(6): 650. 10.3390/-antibiotics10060650
Roman, A.Y., Devred, F., Lobatchov, V.M., Makarov, A.A., Peyrot, V., Kubatiev, A.A., and Tsvetkov, P.O. 2016. Sequential binding of calcium ions to the B-repeat domain of SdrD from Staphylococcus aureus. Canadian Journal of Microbiology 62(2): 123–129. 10.1139/cjm-2015-0580
Silva, V., Almeida, L., Gaio, V., Cerca, N., Manageiro, V., Caniça, M., Capelo, J.L., Igrejas, G., and Poeta, P. 2021. Biofilm formation of multidrug-resistant MRSA strains isolated from different types of human infections. Pathogens (Basel, Switzerland) 10(8): 970. 10.3390/pathogens10080970
Somrani, M., Debbabi, H., and Palop, A. 2022. Antibacterial and antibiofilm activity of essential oil of clove against Listeria monocytogenes and Salmonella enteritidis. Food Science and Technology International (Ciencia Y Tecnologia De Los Alimentos Internacional) 28(4): 331–339. 10.1177/10820132211013273
Sultan, A.R., Swierstra, J.W., Lemmens-den Toom, N.A., Snijders, S.V., Hansenová Maňásková, S., Verbon, A., and van Wamel, W.J.B. 2018. Production of staphylococcal complement inhibitor (SCIN) and other immune modulators during the early stages of Staphylococcus aureus biofilm formation in a mammalian cell culture medium. Infection and Immunity 86(8): e00352-18. 10.1128/IAI.00352-18
Swearingen, M.C., Granger, J.F., Sullivan, A., and Stoodley, P. 2016. Elution of antibiotics from poly (methyl methacrylate) bone cement after extended implantation does not necessarily clear the infection despite susceptibility of the clinical isolates. Pathogens and Disease 74(1): ftv103. 10.1093/femspd/ftv103
Tong, S.Y.C., Davis, J.S., Eichenberger, E., Holland, T.L., and Fowler, V.G. 2015. Staphylococcus aureus infections: epidemiology, pathophysiology, clinical manifestations, and management. Clinical Microbiology Reviews 28(3): 603–661. 10.1128/CMR.00134-14
Valarezo, E., Ledesma-Monteros, G., Jaramillo-Fierro, X., Radice, M., and Meneses, M.A. 2025. Antioxidant application of clove (Syzygium aromaticum) essential oil in meat and meat products: a systematic review. Plants 14(13): 1958. 10.3390/plants14131958
Vasile, C., Sivertsvik, M., Miteluţ, A.C., Brebu, M.A., Stoleru, E., Rosnes, J.T., Tănase, E.E., Khan, W., Pamfil, D., Cornea, C.P., Irimia, A., and Popa, M.E. 2017. Comparative analysis of the composition and active property evaluation of certain essential oils to assess their potential applications in active food packaging. Materials 10(1): 45. 10.3390/ma10010045
Vergara, A., Normanno, G., Di Ciccio, P., Pedonese, F., Nuvoloni, R., Parisi, A., Santagada, G., Colagiorgi, A., Zanardi, E., Ghidini, S., and Ianieri, A. 2017. Biofilm formation and its relationship with the molecular characteristics of food--related methicillin-resistant Staphylococcus aureus (MRSA). Journal of Food Science 82(10): 2364–2370. 10.1111/1750-3841.13846
Xie, L.B., Yu, D., Li, Y.N., Ju, H.D., Chen, J., Hu, L.X., and Yu, L.Q. 2022. Characterization, hypoglycemic activity, and antioxidant activity of methanol extracts from Amomum tsao-ko: in vitro and in vivo studies. Frontiers in Nutrition 9: 869749. 10.3389/fnut.2022.869749
Yan, Z.F., Guo, J.R., Chen, Q.M., Wan, S.B., Qin, Z., and Gao, H.Y. 2025. Antibiofilm activity of Amomum tsaoko essential oil on Staphylococcus aureus and its application in pork preservation. Foods (Basel, Switzerland) 14(4): 662. 10.3390/foods14040662
Yanakiev, S. 2020. Effects of cinnamon (Cinnamomum spp.) in dentistry: a review. Molecules (Basel, Switzerland) 25(18): 4184. 10.3390/molecules25184184
Yin, W., Wang, Y.T., Liu, L., and He, J. 2019. Biofilms: the microbial “protective clothing” in extreme environments. International Journal of Molecular Sciences 20(14): 3423. 10.3390/ijms20143423
Yu, J.Y., Han, W.H., Xu, Y.L., Shen, L., Zhao, H.L., Zhang, J., Xiao, Y.H., Guo, Y.J., and Yu, F.Y. 2024a. Biofilm-producing ability of methicillin-resistant Staphylococcus aureus clinically isolated in China. BMC Microbiology 24: 241. 10.1186/s12866-024-03380-8
Yu, X.H., Hu, E.H., Liu, F.Y., Zhang, Y., Li, W.W., Lyu, Y.M., Li, F.W., Wang, D.J., and Jin, W.B. 2024b. Preparation and characterization of polyphenol-chitosan conjugate-eugenol essential oil microcapsule and its effect on storage behavior of cherry tomato. Journal of Food Science 89(12): 9577–9594. 10.1111/1750-3841.17524
Zhang, T.-T., Lu, C.-L., and Jiang, J.-G. 2015. Antioxidant and anti-tumour evaluation of compounds identified from fruit of Amomum tsaoko Crevost et Lemaire. Journal of Functional Foods 18: 423–431. 10.1016/j.jff.2015.08.005
Supplementary Material
Figure S1. Effect of (A) AEO and (B) CEO on the growth of S. aureus NCTC8325; *P < 0.05, ***P < 0.001, ****P < 0.0001.
Figure S2. Expression of DEGs with (A) AEO treaded and (B) CEO treaded as verified by qRT-PCR. The resulting data were derived from the average of three independent replicates.
Figure S3. The inhibitory and eradication effect of different concentrations of (A and C) AEO and (B and D) CEO on biofilm formation of S. aureus ATCC43300; ***P < 0.001, ****P < 0.0001.
Table S1. List of primers used for quantitative real-time PCR analysis.
| Gene | Forward primer (5’→3’) | Reverse primer (5’→3’) |
|---|---|---|
| Tpi | CGTTGTTATCGGTCATTCT | TTACCACTTTCACGCTCTT |
| icaC | GAGCAATGTTGTGTATTATCATTA | GTCTAAGATCATCGCCATCAA |
| icaB | ATGGTCAAGCCCAGACAGAG | AGTATTTTCAATGTTTAAAGCA |
| agrB | ATTGACCAGTTCGCCACG | AGCTAAGACCTGCATCCC |
| fnbB | TTCTCCATTGGCGGCTCTG | CTCAGGGCGACGGTAAAGA |
| clfB | ATTTGGGATAGGCAATCATCA | TTCGGAATCTGCACTTGC |
Table S2. The DEGs of biofilm in AEO treatment group and control group of S. aureus NCTC8325.
| gene_id | gene_name | log2(FC) | p.adjust |
|---|---|---|---|
| SAOUHSC_02892 | —— | 4.9812973627227 | 1.2616085922635E-155 |
| SAOUHSC_02460 | —— | 4.3088781511459 | 4.0635963128018E-92 |
| SAOUHSC_02640 | hrtA | –3.802970628 | 4.0640919448465E-59 |
| SAOUHSC_02873 | copA | 3.7046325222782 | 8.8688713861986E-56 |
| SAOUHSC_02641 | hrtB | –5.343341594 | 7.5528083913832E-50 |
| SAOUHSC_02893 | —— | 4.5552888598952 | 1.5652210469833E-34 |
| SAOUHSC_00812 | clfA | 1.9504973458514 | 1.5146165396167E-33 |
| SAOUHSC_02848 | ptsG | 2.0772464277297 | 1.6801475083043E-33 |
| SAOUHSC_00142 | —— | –2.776732187 | 6.0683623075041E-32 |
| SAOUHSC_03033 | hoxN | 2.2237163741004 | 4.784610999134E-29 |
| SAOUHSC_00061 | ohyA | 1.9464333783259 | 9.0513878172858E-29 |
| SAOUHSC_02814 | —— | 1.7126741408113 | 5.4075165665171E-28 |
| SAOUHSC_02829 | —— | 1.8343579907581 | 1.3209478387551E-26 |
| SAOUHSC_02098 | vraR | 2.1686262969553 | 6.9602914668914E-26 |
| SAOUHSC_02590 | —— | 1.5997556678808 | 1.2922178905178E-25 |
| SAOUHSC_02381 | dps | –1.765520514 | 7.1420756252086E-25 |
| SAOUHSC_00181 | —— | 2.6794894898484 | 9.4426265439069E-25 |
| SAOUHSC_00581 | rclA | 1.7225969808557 | 5.8042746405277E-24 |
| SAOUHSC_02813 | —— | 1.6827511424034 | 2.7368026752143E-23 |
| SAOUHSC_02828 | catE | 2.1740963078149 | 6.2923184432628E-23 |
| SAOUHSC_01235 | pyrH | –1.765205942 | 1.6658831257075E-22 |
| SAOUHSC_02597 | glvC | 1.7242782443076 | 7.2253258636296E-22 |
| SAOUHSC_00582 | —— | 1.5474379567862 | 1.0526395335E-21 |
| SAOUHSC_02243 | hlg | –1.947125352 | 3.3099765805128E-21 |
| SAOUHSC_02874 | copZ | 2.9507060405206 | 3.8500292210671E-21 |
| SAOUHSC_02812 | —— | 1.5500213138257 | 4.7703423953641E-21 |
| SAOUHSC_00180 | —— | 3.0520024220722 | 5.5174893289492E-21 |
| SAOUHSC_00155 | ptsG | 1.6034774005267 | 2.9861509000346E-18 |
| SAOUHSC_00160 | —— | 3.1908779837242 | 1.026674599099E-17 |
| SAOUHSC_00179 | —— | 2.4668264181715 | 6.2798263854998E-17 |
| SAOUHSC_00320 | ssuE | 1.9733539708746 | 8.7066059838313E-17 |
| SAOUHSC_02706 | sbi | –2.442659459 | 8.7066059838313E-17 |
| SAOUHSC_02923 | —— | 2.4712156535685 | 1.158293276562E-16 |
| SAOUHSC_01945 | epiG | 1.3234239223971 | 1.2845502829073E-16 |
| SAOUHSC_01918 | —— | 0.99828261499905 | 7.2775550161543E-16 |
| SAOUHSC_02108 | ftnA | –1.699417059 | 2.9629155700788E-15 |
| SAOUHSC_02988 | asp1 | 1.3463898104289 | 3.4353765625306E-15 |
| SAOUHSC_02729 | cycA | 1.5559741490099 | 4.9707304251896E-15 |
| SAOUHSC_00319 | —— | 1.874663933 | 5.496095540563E-15 |
| SAOUHSC_01266 | korA | –1.469714042 | 5.9062918122696E-15 |
| SAOUHSC_00529 | fusA | 0.98102644445459 | 9.8277066240848E-15 |
| SAOUHSC_02241 | hlg | –1.595043198 | 9.8958318563622E-15 |
| SAOUHSC_00604 | —— | 1.9512631866334 | 9.8958318563622E-15 |
| SAOUHSC_01728 | —— | 1.9382876212222 | 1.2880474785413E-14 |
| SAOUHSC_02708 | hlg | –2.399305887 | 1.2880474785413E-14 |
| SAOUHSC_00382 | —— | 1.2478572104542 | 1.8657591064733E-14 |
| SAOUHSC_01034 | trkA | 1.420742469 | 2.2024057841483E-14 |
| SAOUHSC_01702 | mtnN | –1.318316913 | 3.1402195072145E-14 |
| SAOUHSC_02360 | tdk | –1.578232195 | 4.214817143322E-14 |
| SAOUHSC_00158 | scrA | 2.1032959204232 | 4.3044357105817E-14 |
| SAOUHSC_01193 | fakA | –1.530285043 | 4.4783265237087E-14 |
| SAOUHSC_00141 | —— | –1.221573595 | 8.0510472678167E-14 |
| SAOUHSC_02830 | ldhA | 1.6720397734479 | 4.0050713272812E-13 |
| SAOUHSC_00027 | rlmH | –1.222058769 | 8.6264149062115E-13 |
| SAOUHSC_00178 | ganQ | 1.7916760822216 | 9.4897681399537E-13 |
| SAOUHSC_00455 | —— | –1.171123493 | 9.9980433614548E-13 |
| SAOUHSC_03019 | ecfA | 2.1454054116014 | 9.9980433614548E-13 |
| SAOUHSC_02709 | hlg | –1.833758745 | 1.1157515919315E-12 |
| SAOUHSC_00195 | fadA | 2.5327815633557 | 4.0870893121845E-12 |
| SAOUHSC_00499 | pdxS | –1.259035745 | 4.1951724798027E-12 |
| SAOUHSC_02912 | phnB | 1.3366145663388 | 5.2304711259553E-12 |
| SAOUHSC_02430 | fecB | –1.73556977 | 6.2890726506754E-12 |
| SAOUHSC_02809 | gntR | –1.170405289 | 8.6425682610342E-12 |
| SAOUHSC_00376 | —— | –1.518739649 | 9.0181387320184E-12 |
| SAOUHSC_00613 | —— | –1.254862483 | 1.7348077595516E-11 |
| SAOUHSC_01124 | —— | 1.4259904693141 | 1.8894742973471E-11 |
| SAOUHSC_02862 | clpL | 1.035932333 | 2.5098246075334E-11 |
| SAOUHSC_02383 | —— | –0.797197675 | 2.5098246075334E-11 |
| SAOUHSC_01606 | pepT | 0.99514006311724 | 2.6142711138323E-11 |
| SAOUHSC_01232 | rpsB | –1.388009815 | 2.6810271362762E-11 |
| SAOUHSC_00025 | —— | –1.22589015 | 3.100909907834E-11 |
| SAOUHSC_00241 | rbsU | –1.240644312 | 4.9906066867976E-11 |
| SAOUHSC_01649 | gluP | –1.206044898 | 5.0079867959024E-11 |
| SAOUHSC_02113 | rumA | 1.2370441711399 | 5.265572569033E-11 |
| SAOUHSC_01919 | —— | 1.1247891229871 | 6.0647277378333E-11 |
| SAOUHSC_03020 | mtsT | 2.259395698 | 6.2691437423439E-11 |
| SAOUHSC_02888 | —— | 2.4263129659648 | 6.474307291851E-11 |
| SAOUHSC_02987 | asp2 | 1.323870398 | 1.7161204413649E-10 |
| SAOUHSC_00300 | lip | –1.292588319 | 1.7583005839364E-10 |
| SAOUHSC_01858 | —— | –1.055156142 | 1.7595153199587E-10 |
| SAOUHSC_01236 | frr | –1.182659004 | 1.9606554694871E-10 |
| SAOUHSC_01254 | —— | –1.393000099 | 2.1797132605756E-10 |
| SAOUHSC_01164 | pyrR | –1.805457824 | 2.2062978734976E-10 |
| SAOUHSC_00533 | hchA | 1.4873791633483 | 2.2062978734976E-10 |
| SAOUHSC_00663 | —— | 1.1139905366169 | 2.4610790920879E-10 |
| SAOUHSC_02990 | —— | 1.3362510095864 | 2.5760445725243E-10 |
| SAOUHSC_01859 | —— | –1.275889022 | 2.8354546903252E-10 |
| SAOUHSC_01192 | —— | –1.274045354 | 3.8189640612085E-10 |
| SAOUHSC_00132 | —— | 1.4753222348554 | 3.8657717496224E-10 |
| SAOUHSC_01114 | fib | –1.498428693 | 4.2421785279374E-10 |
| SAOUHSC_00426 | metQ | 1.5752537889927 | 4.4565637500655E-10 |
| SAOUHSC_00067 | lutP | –1.28887147 | 4.8942336691147E-10 |
| SAOUHSC_02100 | —— | 1.6472645325183 | 5.1145382363507E-10 |
| SAOUHSC_03021 | —— | 2.3273293795204 | 6.5724252540792E-10 |
| SAOUHSC_01886 | ribH | 1.723885463 | 6.9079718432259E-10 |
| SAOUHSC_01504 | fer | –1.299446587 | 1.1032913893406E-9 |
| SAOUHSC_02768 | cntM | –1.940415404 | 1.4096457981998E-9 |
| SAOUHSC_00192 | —— | –2.413024215 | 2.2558610442588E-9 |
| SAOUHSC_01432 | msrA | 1.2146134167572 | 2.9147976683669E-9 |
| SAOUHSC_02359 | prfA | –0.943236478 | 3.1272889685367E-9 |
| SAOUHSC_02924 | puuE | 2.0361999715529 | 3.694901236947E-9 |
| SAOUHSC_00607 | —— | 1.3498000335602 | 3.771413652202E-9 |
| SAOUHSC_00632 | mnhG | 1.1895665442637 | 3.771413652202E-9 |
| SAOUHSC_00459 | rsmI | –1.410040089 | 3.9536175731927E-9 |
| SAOUHSC_01701 | yqeG | –1.051285728 | 4.9361794638529E-9 |
| SAOUHSC_02820 | —— | –1.149959723 | 5.8859743247679E-9 |
| SAOUHSC_02285 | leuA | 2.1654765817252 | 7.2285260357645E-9 |
| SAOUHSC_00457 | —— | –1.30154422 | 8.206123139465E-9 |
| SAOUHSC_00893 | —— | 1.3005406653973 | 1.0347826711068E-8 |
| SAOUHSC_00318 | —— | 1.5054162525125 | 1.0495589131075E-8 |
| SAOUHSC_01949 | nisP | 1.4829090114814 | 1.4610343233936E-8 |
| SAOUHSC_02373 | ldmS | 1.2307060790119 | 1.5920987724187E-8 |
| SAOUHSC_01395 | asd | 1.1603445212256 | 1.6810977264395E-8 |
| SAOUHSC_01018 | purD | 1.9163346374657 | 1.9030494576351E-8 |
| SAOUHSC_02860 | —— | 0.73810713423523 | 1.9075843252861E-8 |
| SAOUHSC_00962 | —— | 2.1389244576378 | 1.9201157740704E-8 |
| SAOUHSC_02872 | —— | 1.5719624107855 | 2.072812127203E-8 |
| SAOUHSC_00898 | argH | 1.7048556847569 | 2.1823482062348E-8 |
| SAOUHSC_01901 | talB | 1.2118681053043 | 2.255409886267E-8 |
| SAOUHSC_02769 | cntL | –1.649501546 | 2.2784901193307E-8 |
| SAOUHSC_01327 | katE | 1.5196840670131 | 2.3149946552756E-8 |
| SAOUHSC_00196 | fadN | 2.6667686786359 | 2.3868296785886E-8 |
| SAOUHSC_01394 | lysC | 1.4490292291064 | 2.4340848426802E-8 |
| SAOUHSC_01267 | korB | –1.102606279 | 2.6636879473733E-8 |
| SAOUHSC_01242 | rimP | –1.165504439 | 2.9040227108662E-8 |
| SAOUHSC_00310 | ulaA | 2.0372618210809 | 3.2136711542147E-8 |
| SAOUHSC_00693 | cydC | 1.0624026473719 | 3.3507308447202E-8 |
| SAOUHSC_02550 | fdhD | 1.2458242731354 | 3.4476937519686E-8 |
| SAOUHSC_02762 | —— | 1.0985457269613 | 3.5017827159239E-8 |
| SAOUHSC_02864 | feoB | 1.3210412975431 | 3.5017827159239E-8 |
| SAOUHSC_01501 | —— | 0.91384852764912 | 4.5173598531215E-8 |
| SAOUHSC_01744 | recJ | –0.833779031 | 4.6150656536111E-8 |
| SAOUHSC_00191 | scn | –1.931656738 | 4.7201382128235E-8 |
| SAOUHSC_01031 | cydA | 1.0999936938232 | 4.7471261830691E-8 |
| SAOUHSC_00369 | —— | –0.755288521 | 4.8064417584821E-8 |
| SAOUHSC_00733 | hisC | 1.5505824027782 | 4.8215818644781E-8 |
| SAOUHSC_02964 | arcR | –1.125819314 | 4.9202846281603E-8 |
| SAOUHSC_01165 | uraA | –1.721357759 | 5.1056024078757E-8 |
| SAOUHSC_00174 | lytH | 1.9178194620661 | 5.4775680142448E-8 |
| SAOUHSC_00201 | —— | 1.6205395817783 | 6.1160969912282E-8 |
| SAOUHSC_00454 | holB | –1.472492664 | 6.6703191363449E-8 |
| SAOUHSC_02099 | vraS | 1.7887123714184 | 6.7873529070562E-8 |
| SAOUHSC_02459 | —— | 2.1298276358064 | 7.1885637959271E-8 |
| SAOUHSC_02646 | —— | –1.086909873 | 7.3919239928366E-8 |
| SAOUHSC_00536 | ilvE | 0.85384214368477 | 8.3432974665472E-8 |
| SAOUHSC_02698 | tcyB | 0.96113726501113 | 9.0454125549615E-8 |
| SAOUHSC_02967 | arcD | –1.095501913 | 9.0525624314575E-8 |
| SAOUHSC_00606 | —— | 1.1133365605302 | 9.3307233865564E-8 |
| SAOUHSC_00562 | pdxK | 0.70083697660263 | 1.1709267565964E-7 |
| SAOUHSC_01431 | msrB | 0.9736635315573 | 1.1795329286658E-7 |
| SAOUHSC_01396 | dapA | 1.4076057152405 | 1.267018768086E-7 |
| SAOUHSC_00639 | —— | 0.98431731284708 | 1.308042287639E-7 |
| SAOUHSC_02385 | manA | –1.656094794 | 1.3433436485752E-7 |
| SAOUHSC_02314 | kdpD | –1.176000019 | 1.3441471784766E-7 |
| SAOUHSC_00886 | mnhD | 1.021794726 | 1.5549460242702E-7 |
| SAOUHSC_00612 | —— | –1.475602692 | 1.7198551635557E-7 |
| SAOUHSC_02659 | —— | –0.86657217 | 1.7640076120807E-7 |
| SAOUHSC_02494 | rpsE | 1.0774829705758 | 1.9153151873499E-7 |
| SAOUHSC_00531 | —— | 1.0207994865198 | 1.9483237083018E-7 |
| SAOUHSC_02485 | rpoA | 0.98664936421144 | 1.9483237083018E-7 |
| SAOUHSC_01833 | serA | 1.4030124402198 | 2.0101788491093E-7 |
| SAOUHSC_01688 | lepA | –0.926105825 | 2.0816969879392E-7 |
| SAOUHSC_00282 | —— | 1.8031855992168 | 2.1703672993893E-7 |
| SAOUHSC_00036 | gloB | 1.0489042595484 | 2.213877428294E-7 |
| SAOUHSC_01324 | —— | –1.559162063 | 2.213877428294E-7 |
| SAOUHSC_01234 | tsf | –0.833658826 | 2.2730071874012E-7 |
| SAOUHSC_03027 | —— | 1.5435635171913 | 2.6206907042282E-7 |
| SAOUHSC_01115 | scn | –1.786068561 | 2.6613816962845E-7 |
| SAOUHSC_01920 | —— | –1.188349035 | 2.6920107736567E-7 |
| SAOUHSC_01486 | hepT | –0.974020011 | 2.786512710937E-7 |
| SAOUHSC_01838 | degP | 0.69578892247868 | 2.8590885629965E-7 |
| SAOUHSC_01100 | trxA | 1.2598714653735 | 3.0243326084651E-7 |
| SAOUHSC_01467 | mrcA | 0.8489199212754 | 3.1197694605866E-7 |
| SAOUHSC_02931 | —— | –1.518982725 | 3.9892130735909E-7 |
| SAOUHSC_01846 | acs | 1.1543831492995 | 4.2982517501031E-7 |
| SAOUHSC_01144 | ftsL | –0.921514543 | 4.7310649800335E-7 |
| SAOUHSC_01601 | malZ | 0.87970964931241 | 4.7310649800335E-7 |
| SAOUHSC_02669 | ohrR | 0.93270869393561 | 4.9738162412879E-7 |
| SAOUHSC_02117 | gatA | –0.681894933 | 5.1681207361443E-7 |
| SAOUHSC_00788 | —— | 0.95983562438315 | 5.6024579208098E-7 |
| SAOUHSC_01591 | xerD | –0.88950718 | 6.345770006855E-7 |
| SAOUHSC_02887 | —— | –2.108541878 | 6.345770006855E-7 |
| SAOUHSC_00785 | trxB | 0.88568831767558 | 6.345770006855E-7 |
| SAOUHSC_01263 | rny | 0.74312077840188 | 6.4991559177502E-7 |
| SAOUHSC_02276 | —— | –1.200846005 | 6.8614955795884E-7 |
| SAOUHSC_01017 | purH | 1.8239681008547 | 6.8614955795884E-7 |
| SAOUHSC_02259 | yafV | 0.76371211104669 | 7.0484342042583E-7 |
| SAOUHSC_02257 | —— | –1.318213065 | 7.3612774155516E-7 |
| SAOUHSC_00530 | tuf | 0.88010982863816 | 8.605218241042E-7 |
| SAOUHSC_02161 | eap | –1.362122112 | 8.9442443506994E-7 |
| SAOUHSC_00187 | pflD | 1.3077396216266 | 1.022582113361E-6 |
| SAOUHSC_02487 | rpsM | 1.1376238383284 | 1.1080367531902E-6 |
| SAOUHSC_01174 | —— | 0.7714391613006 | 1.1397331615013E-6 |
| SAOUHSC_01813 | —— | –0.635444279 | 1.1724134971798E-6 |
| SAOUHSC_01135 | psmB | 1.3180429461301 | 1.2067770279042E-6 |
| SAOUHSC_02770 | cntK | –1.815728196 | 1.2929987692554E-6 |
| SAOUHSC_03031 | rarD | 0.852613455 | 1.302101213401E-6 |
| SAOUHSC_01243 | nusA | –1.104661371 | 1.3619536745365E-6 |
| SAOUHSC_02495 | rplR | 1.2105495612959 | 1.3619536745365E-6 |
| SAOUHSC_00878 | ndh | –0.727807139 | 1.4655955321184E-6 |
| SAOUHSC_00424 | metI | 1.4916376338483 | 1.4655955321184E-6 |
| SAOUHSC_02808 | gntK | –0.991192077 | 1.5878748864181E-6 |
| SAOUHSC_01007 | folD | 0.8012964895053 | 1.5931258045401E-6 |
| SAOUHSC_01632 | gcvPB | 1.2804938445621 | 1.6995405847555E-6 |
| SAOUHSC_00544 | sdrC_D_E | –0.881008985 | 1.7629918905776E-6 |
| SAOUHSC_02638 | —— | 1.1243703510097 | 1.7769960305983E-6 |
| SAOUHSC_01321 | thrC | 1.4292484679994 | 1.8525359216603E-6 |
| SAOUHSC_02142 | crtNc | 1.2918867202226 | 1.9939812986937E-6 |
| SAOUHSC_02279 | tsaB | –0.956837571 | 2.0494044760002E-6 |
| SAOUHSC_01050 | —— | 0.86004511570309 | 2.3980341365731E-6 |
| SAOUHSC_01430 | crr | 0.81677276743561 | 2.4037945072122E-6 |
| SAOUHSC_01832 | —— | 1.3434645895408 | 2.6306541805987E-6 |
| SAOUHSC_02218 | —— | –2.176422347 | 2.7269324966812E-6 |
| SAOUHSC_01398 | dapH | 1.3595060893932 | 2.9318914524815E-6 |
| SAOUHSC_00366 | nfrA1 | 0.95334369439121 | 3.0828644417069E-6 |
| SAOUHSC_00398 | hsdS | –1.252864968 | 3.138851619963E-6 |
| SAOUHSC_01203 | rnc | –0.889363931 | 3.2304546821485E-6 |
| SAOUHSC_02286 | leuB | 2.1674029687986 | 3.570074303742E-6 |
| SAOUHSC_01397 | dapB | 1.2457334201434 | 3.6578898250665E-6 |
| SAOUHSC_00397 | hsdM | –1.284892112 | 3.6578898250665E-6 |
| SAOUHSC_00899 | argG | 1.595505719 | 3.6578898250665E-6 |
| SAOUHSC_02284 | ilvC | 2.1648104934462 | 3.7283720304394E-6 |
| SAOUHSC_01130 | —— | 1.362858771 | 3.7283720304394E-6 |
| SAOUHSC_00818 | nuc | –2.330755588 | 3.7283720304394E-6 |
| SAOUHSC_00188 | pflA | 1.6795915799714 | 3.9959568830839E-6 |
| SAOUHSC_00013 | metX | 1.3055306369346 | 4.0115661551796E-6 |
| SAOUHSC_02337 | murA | –0.818231493 | 4.090585477364E-6 |
| SAOUHSC_01699 | aroE | –0.943968868 | 4.2623747726835E-6 |
| SAOUHSC_00422 | mccB | 1.693758466 | 4.3970686599295E-6 |
| SAOUHSC_00638 | troR | –0.711222068 | 4.5582073582414E-6 |
| SAOUHSC_01005 | —— | 1.1267472776462 | 4.5582073582414E-6 |
| SAOUHSC_01663 | dnaG | –1.203425839 | 4.5974884682555E-6 |
| SAOUHSC_00323 | —— | 1.4121618971507 | 5.1095895039381E-6 |
| SAOUHSC_00217 | gutB | 1.5444651562851 | 5.4770152021206E-6 |
| SAOUHSC_02386 | —— | –1.707961085 | 6.0531099067213E-6 |
| SAOUHSC_01700 | yqeH | –0.903479629 | 6.0531099067213E-6 |
| SAOUHSC_01224 | xerC | 0.71095689887434 | 6.0531099067213E-6 |
| SAOUHSC_02491 | secY | 0.96882650696268 | 6.2209841272766E-6 |
| SAOUHSC_00074 | sirA | –1.240478978 | 6.2209841272766E-6 |
| SAOUHSC_01485 | ndk | –1.237218696 | 6.2764333889068E-6 |
| SAOUHSC_01226 | hslU | 0.79647429284945 | 6.4955604569037E-6 |
| SAOUHSC_00749 | yclQ | 1.1581493977705 | 6.7751496713566E-6 |
| SAOUHSC_00177 | ganP | 0.95206866305157 | 7.1728116162158E-6 |
| SAOUHSC_00716 | doxD | –1.00005449 | 7.5134592356348E-6 |
| SAOUHSC_02965 | arcC | –1.033022855 | 8.7968110982036E-6 |
| SAOUHSC_01218 | sucD | 0.87575604765112 | 9.4980967689476E-6 |
| SAOUHSC_02169 | chp | –1.422733036 | 9.5400248145019E-6 |
| SAOUHSC_02710 | hlg | –1.278970431 | 9.5762508403461E-6 |
| SAOUHSC_00484 | tilS | –0.785413337 | 9.6184206727799E-6 |
| SAOUHSC_02731 | nhaK | 0.81282468864351 | 1.1138008616855E-5 |
| SAOUHSC_00135 | —— | 1.4550401218009 | 1.1484044529077E-5 |
| SAOUHSC_00939 | glbN | 0.90753799877592 | 1.2045373095686E-5 |
| SAOUHSC_00577 | mvaK1 | –1.059047144 | 1.2822203190991E-5 |
| SAOUHSC_00170 | —— | 1.5042141195624 | 1.2843059628798E-5 |
| SAOUHSC_01673 | phoH | –0.596982823 | 1.2990264869554E-5 |
| SAOUHSC_01889 | ribD | 1.3238483121846 | 1.3077955753061E-5 |
| SAOUHSC_01460 | ypsC | –1.156407427 | 1.4002408685171E-5 |
| SAOUHSC_00658 | dhaM | 1.3042013462649 | 1.4011354658923E-5 |
| SAOUHSC_01981 | —— | –0.88766314 | 1.4011354658923E-5 |
| SAOUHSC_01598 | rnz | –0.993869863 | 1.415606339997E-5 |
| SAOUHSC_02611 | —— | –1.718886651 | 1.4500345539148E-5 |
| SAOUHSC_00031 | —— | 1.051566049 | 1.4962059240051E-5 |
| SAOUHSC_02929 | acs | 0.73781166958883 | 1.5618338191758E-5 |
| SAOUHSC_02170 | —— | –0.826092313 | 1.5618338191758E-5 |
| SAOUHSC_02097 | —— | –0.699813599 | 1.5618338191758E-5 |
| SAOUHSC_02282 | ilvB | 1.7594140165055 | 1.6598332417975E-5 |
| SAOUHSC_02428 | fecC | –1.03530366 | 1.6598332417975E-5 |
| SAOUHSC_00656 | dhaL | 1.0617796769587 | 1.6598332417975E-5 |
| SAOUHSC_00423 | metN | 1.3500028730269 | 1.7325848079093E-5 |
| SAOUHSC_02119 | putP | 0.76849427055951 | 1.7394839568209E-5 |
| SAOUHSC_02486 | rpsK | 0.87394654170986 | 1.7428330354386E-5 |
| SAOUHSC_02287 | leuC | 1.9739051770443 | 1.7888890636379E-5 |
| SAOUHSC_02492 | rplO | 0.97740604786551 | 1.8019456512616E-5 |
| SAOUHSC_01910 | pckA | 0.72453129468353 | 1.8470668925059E-5 |
| SAOUHSC_00024 | —— | –0.779234508 | 1.8470668925059E-5 |
| SAOUHSC_02484 | rplQ | 0.81487881455487 | 1.8928845931818E-5 |
| SAOUHSC_02972 | —— | 0.93170613373332 | 1.899164962891E-5 |
| SAOUHSC_02899 | —— | 0.8878897176633 | 1.9516301886993E-5 |
| SAOUHSC_00543 | —— | –1.237662635 | 1.9561107224713E-5 |
| SAOUHSC_01944 | —— | –1.587443683 | 1.9626636286347E-5 |
| SAOUHSC_00814 | —— | –2.456916898 | 2.0333906022291E-5 |
| SAOUHSC_01440 | yhhQ | 0.74229495009487 | 2.0420544499808E-5 |
| SAOUHSC_00729 | uup | –0.920539002 | 2.2034260890958E-5 |
| SAOUHSC_02727 | —— | 0.70234483564985 | 2.2201053132597E-5 |
| SAOUHSC_00199 | pct | 1.3431376108205 | 2.4655978213683E-5 |
| SAOUHSC_01887 | ribBA | 1.3275933933569 | 2.4712540890603E-5 |
| SAOUHSC_00957 | —— | 0.67961505764179 | 2.4906311430878E-5 |
| SAOUHSC_02216 | dnaC | –3.198478421 | 2.4906311430878E-5 |
| SAOUHSC_00938 | —— | 0.62050875476907 | 2.5286078920613E-5 |
| SAOUHSC_02755 | —— | 0.66479416320389 | 2.9769754510147E-5 |
| SAOUHSC_00259 | —— | 0.91036720908362 | 3.000648002723E-5 |
| SAOUHSC_02004 | ygaC | –0.721072556 | 3.0893478700069E-5 |
| SAOUHSC_01980 | —— | –1.108568903 | 3.358984601784E-5 |
| SAOUHSC_01609 | —— | 0.84878075619446 | 3.4301163927154E-5 |
| SAOUHSC_01840 | sgtA | –0.92456214 | 3.4803988314131E-5 |
| SAOUHSC_00006 | gyrA | –0.59206397 | 3.5227949000157E-5 |
| SAOUHSC_00520 | rplJ | 0.81285487137708 | 3.5688784108203E-5 |
| SAOUHSC_00004 | recF | –0.841898608 | 3.6897732895182E-5 |
| SAOUHSC_01866 | —— | –0.614907108 | 4.0336484453081E-5 |
| SAOUHSC_00202 | —— | 2.050742718 | 4.0354250452079E-5 |
| SAOUHSC_00329 | tatA | 0.91564114694227 | 4.0726937123846E-5 |
| SAOUHSC_01416 | sucB | 0.76806815390388 | 4.2876020507266E-5 |
| SAOUHSC_00927 | oppA | 1.4035113740206 | 4.3019809401867E-5 |
| SAOUHSC_01888 | ribE | 1.4310408772433 | 4.4094853999669E-5 |
| SAOUHSC_01588 | scpB | –0.63447059 | 4.4125198176013E-5 |
| SAOUHSC_00912 | clpB | –1.367444112 | 4.4147060485985E-5 |
| SAOUHSC_02299 | rsbW | –0.818768336 | 4.4382706724802E-5 |
| SAOUHSC_01319 | lysC | 1.5339905768234 | 4.5592957341217E-5 |
| SAOUHSC_02274 | —— | –0.740637127 | 4.6175213073212E-5 |
| SAOUHSC_02782 | —— | –3.386641207 | 4.724136698367E-5 |
| SAOUHSC_02790 | —— | –0.934517826 | 5.0590345646185E-5 |
| SAOUHSC_01487 | ubiE | –0.742706289 | 5.108089618296E-5 |
| SAOUHSC_02273 | rex | 0.67220360683395 | 5.108089618296E-5 |
| SAOUHSC_01391 | —— | –0.794745852 | 5.2419707200431E-5 |
| SAOUHSC_01672 | ybeY | –0.740916808 | 5.2419707200431E-5 |
| SAOUHSC_02910 | —— | 0.97430495361603 | 5.2640225710056E-5 |
| SAOUHSC_00060 | yjbB | –1.205301197 | 5.2666802546175E-5 |
| SAOUHSC_02766 | nikB | 1.2519725557457 | 5.4265742373214E-5 |
| SAOUHSC_00427 | sle1 | –1.696658801 | 5.4265742373214E-5 |
| SAOUHSC_02496 | rplF | 1.0370504433076 | 5.4265742373214E-5 |
| SAOUHSC_02926 | —— | 0.89574701749456 | 5.9632241526965E-5 |
| SAOUHSC_02302 | rsbU_P | –0.636212453 | 6.0054675876317E-5 |
| SAOUHSC_00441 | —— | –0.823328991 | 6.3542705191209E-5 |
| SAOUHSC_01245 | —— | –0.818268962 | 6.3741408216915E-5 |
| SAOUHSC_02083 | —— | –2.110135261 | 6.3928856471631E-5 |
| SAOUHSC_00925 | oppD | 1.3154230728937 | 6.5076916859738E-5 |
| SAOUHSC_02697 | tcyC | 1.0795333631125 | 6.623373618737E-5 |
| SAOUHSC_00527 | rpsL | 0.76136310425248 | 6.6485505776462E-5 |
| SAOUHSC_00542 | —— | –1.441896551 | 6.662419092466E-5 |
| SAOUHSC_02557 | utp | 1.1586475003163 | 6.8107302538879E-5 |
| SAOUHSC_00742 | nrdA | 0.84712916280095 | 7.0974952170256E-5 |
| SAOUHSC_02579 | —— | –0.873787918 | 7.1970840877363E-5 |
| SAOUHSC_01183 | fmt | –0.873805641 | 7.1970840877363E-5 |
| SAOUHSC_01914 | —— | 0.75622646536486 | 7.2743516561471E-5 |
| SAOUHSC_00896 | —— | 0.91272890551378 | 7.3291327052038E-5 |
| SAOUHSC_01238 | cdsA | –0.773868658 | 7.769383892833E-5 |
| SAOUHSC_00816 | —— | –1.364933249 | 7.9835073017244E-5 |
| SAOUHSC_01785 | rpmI | –0.974098803 | 8.3309641127194E-5 |
| SAOUHSC_02909 | pyrD | 0.99099899617615 | 8.441461524136E-5 |
| SAOUHSC_00833 | —— | –0.662933194 | 8.6008675436198E-5 |
| SAOUHSC_00204 | hmp | 1.88043129 | 8.7083209541794E-5 |
| SAOUHSC_02705 | —— | –1.20184885 | 8.7157622247231E-5 |
| SAOUHSC_02155 | —— | 0.7246741351582 | 8.9553383140847E-5 |
| SAOUHSC_02225 | —— | –2.871615937 | 9.1090618941427E-5 |
| SAOUHSC_00233 | lrgB | 1.7438428827185 | 9.3550104175566E-5 |
| SAOUHSC_00216 | gatC | 1.6311447369707 | 9.4224611328021E-5 |
| SAOUHSC_01776 | hemA | 0.61223292618069 | 9.8628837161943E-5 |
| SAOUHSC_02012 | sgtB | 1.13858998 | 9.8980704336643E-5 |
| SAOUHSC_00039 | —— | –0.75603706 | 0.00011254746927737 |
| SAOUHSC_01337 | tktA | 0.66028110406041 | 0.00011546611584799 |
| SAOUHSC_02050 | xtmA | –2.513805821 | 0.00011852325728609 |
| SAOUHSC_00232 | lrgA | 2.0333074572107 | 0.00011864716120214 |
| SAOUHSC_02663 | —— | 1.1960247762784 | 0.00011979550583824 |
| SAOUHSC_02752 | pbuE | 0.85920167301195 | 0.00012521025674799 |
| SAOUHSC_02986 | asp3 | 1.228018497 | 0.00012586178769824 |
| SAOUHSC_00949 | —— | 1.3081680800067 | 0.00012677160404406 |
| SAOUHSC_02740 | norB | 0.7131648475486 | 0.00013360855061271 |
| SAOUHSC_02365 | murA | 0.79094758100558 | 0.00013826782982012 |
| SAOUHSC_01979 | —— | –1.313672425 | 0.0001407966179671 |
| SAOUHSC_01322 | thrB | 1.3081408568848 | 0.00014276877254412 |
| SAOUHSC_00907 | —— | –1.181019406 | 0.00014389095491554 |
| SAOUHSC_01320 | hom | 1.0954106268487 | 0.00014417310988861 |
| SAOUHSC_02233 | —— | –2.291856564 | 0.00014999712202225 |
| SAOUHSC_01341 | sbcD | –1.057480168 | 0.00015186113820447 |
| SAOUHSC_00313 | —— | 1.5605581280396 | 0.00015331534078012 |
| SAOUHSC_01086 | htsB | –2.181859866 | 0.00015541206749219 |
| SAOUHSC_00834 | —— | 0.90782133907405 | 0.00017105417905049 |
| SAOUHSC_02281 | ilvD | 1.2616245803529 | 0.00017737336172205 |
| SAOUHSC_01281 | hfq | 0.79363357450001 | 0.00018598632368092 |
| SAOUHSC_01684 | —— | –0.67040399 | 0.00018598632368092 |
| SAOUHSC_01784 | rplT | –1.124134336 | 0.00019780007236985 |
| SAOUHSC_02357 | tsaC | –0.623896866 | 0.00020645707135993 |
| SAOUHSC_01225 | hslV | 0.69134399882815 | 0.00021420721038494 |
| SAOUHSC_00671 | —— | –1.526200981 | 0.00021420721038494 |
| SAOUHSC_00603 | iolS | 0.73799727573021 | 0.00021420721038494 |
| SAOUHSC_02869 | —— | 0.67337238708461 | 0.0002159891044956 |
| SAOUHSC_02723 | glxK | 1.1603438262809 | 0.00022408666398701 |
| SAOUHSC_00037 | sqr | 1.0065120221462 | 0.00022737438134033 |
| SAOUHSC_00803 | rnr | 0.79274236003244 | 0.00022742873766978 |
| SAOUHSC_01399 | —— | 1.181944902 | 0.00023911250369481 |
| SAOUHSC_00139 | —— | 1.1271448045949 | 0.00024236460801637 |
| SAOUHSC_02048 | —— | –2.102104406 | 0.0002453997135816 |
| SAOUHSC_02861 | ogt | 0.74324364865061 | 0.00024625293444165 |
| SAOUHSC_03023 | drp35 | 0.80064003366824 | 0.00024789568525541 |
| SAOUHSC_00005 | gyrB | –0.667940907 | 0.0002534735352978 |
| SAOUHSC_02049 | xtmB | –2.377399199 | 0.00025698954877978 |
| SAOUHSC_02152 | —— | 0.84859471870235 | 0.0002685692017341 |
| SAOUHSC_01081 | isdA | –0.974210796 | 0.0002685692017341 |
| SAOUHSC_02724 | —— | 1.1890603064121 | 0.00027090022845609 |
| SAOUHSC_00156 | —— | 0.74585536011486 | 0.00027298178420151 |
| SAOUHSC_00752 | murB | –0.59699814 | 0.00027298178420151 |
| SAOUHSC_00787 | rapZ | 0.6978494006767 | 0.00027985194968928 |
| SAOUHSC_01725 | mnmA | 0.6723424734556 | 0.00027985194968928 |
| SAOUHSC_01676 | —— | 0.67435131831284 | 0.00030008335339525 |
| SAOUHSC_01204 | smc | –0.715331471 | 0.00030575778848748 |
| SAOUHSC_00610 | —— | –0.934534939 | 0.00031632536552256 |
| SAOUHSC_01786 | infC | –0.915036664 | 0.00031725438092777 |
| SAOUHSC_00339 | yitJ | 1.5064247600219 | 0.00032768891961698 |
| SAOUHSC_01447 | —— | 1.0858936368554 | 0.000336364019618 |
| SAOUHSC_02841 | —— | –0.649977794 | 0.00033709490983796 |
| SAOUHSC_00171 | ggt | 1.0296488331367 | 0.00034207952606835 |
| SAOUHSC_02087 | —— | –1.007252513 | 0.00034422022430859 |
| SAOUHSC_00528 | rpsG | 0.7756532030178 | 0.00035426805412294 |
| SAOUHSC_01792 | dnaB | –0.789108572 | 0.00035436415262318 |
| SAOUHSC_00660 | —— | 0.59436485715263 | 0.00035808753513769 |
| SAOUHSC_01032 | cydB | 1.2572440498275 | 0.00036203221211971 |
| SAOUHSC_02500 | rplE | 0.86729133830553 | 0.00036281956632696 |
| SAOUHSC_02221 | —— | –2.500520833 | 0.00036384184517165 |
| SAOUHSC_02905 | —— | 1.0827334229132 | 0.00036989758058432 |
| SAOUHSC_00157 | murQ | 0.92096607785789 | 0.00038446180365827 |
| SAOUHSC_01932 | hsdS | –0.767907741 | 0.0003932543181325 |
| SAOUHSC_00748 | yclP | 1.1712648935539 | 0.00040246771199353 |
| SAOUHSC_00926 | oppF | 1.2766816488827 | 0.00041055052954774 |
| SAOUHSC_01456 | —— | 0.90848903201456 | 0.00041128645776735 |
| SAOUHSC_02519 | —— | –0.91637934 | 0.00041340744921797 |
| SAOUHSC_03022 | —— | 0.99517393617284 | 0.00041542569467627 |
| SAOUHSC_00687 | —— | –1.501065191 | 0.00046715949977282 |
| SAOUHSC_00628 | mnhD | 0.88667180990839 | 0.0004727336753236 |
| SAOUHSC_00401 | —— | 0.89605549271202 | 0.00047297405820049 |
| SAOUHSC_01166 | pyrB | –1.125685092 | 0.00048473504404233 |
| SAOUHSC_01992 | —— | –1.097885023 | 0.00048855636212426 |
| SAOUHSC_01016 | purN | 1.4271621219011 | 0.00049405438706804 |
| SAOUHSC_00711 | tlyC | –0.699381895 | 0.00049491295442334 |
| SAOUHSC_02388 | czrA | –0.783768371 | 0.00050019968397397 |
| SAOUHSC_01249 | ribF | 0.68614861881995 | 0.00050613854162159 |
| SAOUHSC_02750 | —— | 1.1093077064074 | 0.00050976738665013 |
| SAOUHSC_02871 | —— | 1.0242284494396 | 0.00051818972641696 |
| SAOUHSC_01276 | glpK | 0.72039854228438 | 0.00055459349491295 |
| SAOUHSC_01129 | arcC | 1.4279820008591 | 0.00055459349491295 |
| SAOUHSC_02501 | rplX | 0.78987986940924 | 0.0005817041719656 |
| SAOUHSC_02776 | —— | –0.923504163 | 0.00065837543296324 |
| SAOUHSC_01107 | rdgB | 0.82241655838859 | 0.00071870442781973 |
| SAOUHSC_00828 | lysE | 1.3069324858313 | 0.00071870442781973 |
| SAOUHSC_01400 | alr | 1.1793230512366 | 0.00071872151074164 |
| SAOUHSC_01998 | —— | 0.74176418046096 | 0.00072476518835959 |
| SAOUHSC_02898 | —— | 1.1388051878438 | 0.00074734069207905 |
| SAOUHSC_00895 | gudB | 0.61587322092061 | 0.00075893458616713 |
| SAOUHSC_02490 | adk | 1.0725001450267 | 0.00078105816899077 |
| SAOUHSC_01822 | tpx | 0.60081626600434 | 0.00078105816899077 |
| SAOUHSC_00279 | —— | –1.656392723 | 0.00078105816899077 |
| SAOUHSC_00905 | addA | 0.60865213060246 | 0.00079319859537426 |
| SAOUHSC_00987 | sspB | –1.059866769 | 0.00079320009392889 |
| SAOUHSC_00086 | butA | 0.74485285132525 | 0.00082406857339829 |
| SAOUHSC_01223 | trmFO | 0.66775525711813 | 0.00082406857339829 |
| SAOUHSC_00466 | ispE | –0.841845266 | 0.00083536959824597 |
| SAOUHSC_02880 | crtQ | –0.780897883 | 0.00084966231483705 |
| SAOUHSC_03040 | —— | 0.68371902470449 | 0.00084986103613254 |
| SAOUHSC_00163 | —— | –1.384047486 | 0.00088665732500688 |
| SAOUHSC_01933 | hsdM | –1.041419253 | 0.00089464869992345 |
| SAOUHSC_00198 | fadD | 1.2470087582431 | 0.00089644463229002 |
| SAOUHSC_01237 | uppS | –0.857724648 | 0.00090025880069743 |
| SAOUHSC_02163 | —— | –1.804591427 | 0.0009054806535344 |
| SAOUHSC_02767 | nikA | 0.95926529230569 | 0.001002643951747 |
| SAOUHSC_02822 | fbp3 | 0.89185551202985 | 0.001030479523687 |
| SAOUHSC_01359 | mprF | 0.88342320130448 | 0.0010443969799012 |
| SAOUHSC_02613 | —— | 0.62433319969881 | 0.0010575294131972 |
| SAOUHSC_01589 | scpA | –0.904014237 | 0.0010659810924538 |
| SAOUHSC_02256 | —— | –2.698703421 | 0.0010847568701898 |
| SAOUHSC_02400 | mtlA | –0.85791204 | 0.0010867295460565 |
| SAOUHSC_01051 | —— | 0.83579710329041 | 0.0010950980272323 |
| SAOUHSC_01364 | tyrA2 | 0.80775648258042 | 0.0011038017961222 |
| SAOUHSC_01604 | —— | 0.8616477319511 | 0.001105204924745 |
| SAOUHSC_00869 | dltA | 0.63561940689759 | 0.0011471838599693 |
| SAOUHSC_02154 | —— | 0.6625571206276 | 0.0011482540937695 |
| SAOUHSC_01738 | hisS | –0.601616701 | 0.0011899929058341 |
| SAOUHSC_02660 | corA | –0.827108121 | 0.0011948199701533 |
| SAOUHSC_00715 | saeR | –0.909591934 | 0.0012021906769381 |
| SAOUHSC_00312 | ulaC | 1.7133405322355 | 0.0012088655069429 |
| SAOUHSC_02502 | rplN | 0.79692626688573 | 0.0012130206333667 |
| SAOUHSC_01347 | acnA | 0.82806691833106 | 0.0012166420610098 |
| SAOUHSC_00138 | —— | 1.4854856092355 | 0.0012232709118883 |
| SAOUHSC_02081 | —— | –2.470078256 | 0.001245796468778 |
| SAOUHSC_01182 | def | –0.935956018 | 0.0012753699906644 |
| SAOUHSC_02866 | —— | 1.7017219390292 | 0.0012897423095112 |
| SAOUHSC_02217 | —— | –2.575811769 | 0.0013042310663652 |
| SAOUHSC_02855 | —— | –2.147594831 | 0.0013042310663652 |
| SAOUHSC_02390 | —— | –2.439311318 | 0.0013184453549366 |
| SAOUHSC_00239 | rbsK | –0.850842275 | 0.0013646672990422 |
| SAOUHSC_00169 | —— | 1.643496139 | 0.001386148908563 |
| SAOUHSC_00421 | mccA | 1.4691350093593 | 0.0014458862541992 |
| SAOUHSC_02167 | scn | –1.057618738 | 0.001487001738164 |
| SAOUHSC_00058 | norB | 0.80149050817919 | 0.0014940708612686 |
| SAOUHSC_02030 | —— | –2.224800921 | 0.001535113619989 |
| SAOUHSC_02907 | —— | 0.95525235433018 | 0.001535113619989 |
| SAOUHSC_01839 | tyrS | –0.802117719 | 0.0015718942117767 |
| SAOUHSC_01893 | arsB | 0.75412654873182 | 0.0015898449482923 |
| SAOUHSC_02842 | —— | –4.738446419 | 0.0015954901289791 |
| SAOUHSC_00213 | —— | 1.0788125411575 | 0.0016024843213554 |
| SAOUHSC_02023 | lytD | –2.147454084 | 0.0016345739409906 |
| SAOUHSC_03012 | hisC | 1.4857007688068 | 0.0016369901029372 |
| SAOUHSC_02763 | nikE | 1.1649001975917 | 0.0016882612253098 |
| SAOUHSC_02280 | tsaE | –1.056593006 | 0.0017392247638007 |
| SAOUHSC_01146 | mraY | –0.659590133 | 0.0017867040074626 |
| SAOUHSC_02047 | —— | –1.793019154 | 0.0018363228344796 |
| SAOUHSC_01685 | hrcA | –0.793184439 | 0.0018567635858638 |
| SAOUHSC_00726 | —— | –1.974705372 | 0.0018620798094155 |
| SAOUHSC_01141 | bshC | 0.79911321863463 | 0.0018815501070408 |
| SAOUHSC_00182 | —— | –3.460275865 | 0.0018815501070408 |
| SAOUHSC_02288 | leuD | 1.6803318939333 | 0.0019131146501275 |
| SAOUHSC_02823 | —— | 0.66390952985922 | 0.0019179791772793 |
| SAOUHSC_01690 | holA | –1.26538842 | 0.0019281974988374 |
| SAOUHSC_02127 | sspB2 | –1.276159861 | 0.0019349474228985 |
| SAOUHSC_01764 | comC | –1.77942091 | 0.0019626183627635 |
| SAOUHSC_01718 | —— | –2.050420515 | 0.0019978479120243 |
| SAOUHSC_A01455 | —— | 0.80630753756607 | 0.0019978479120243 |
| SAOUHSC_00667 | vraF | 0.62902497874303 | 0.0020094900687048 |
| SAOUHSC_02088 | —— | –2.253806583 | 0.0020106434000032 |
| SAOUHSC_01228 | codY | 0.85678337577574 | 0.0020224122934266 |
| SAOUHSC_02022 | —— | –2.149642022 | 0.002032940629325 |
| SAOUHSC_00901 | —— | 0.60963530436617 | 0.0020379602021924 |
| SAOUHSC_01650 | —— | –0.967304726 | 0.002044709435342 |
| SAOUHSC_02498 | rpsH | 1.0417023907051 | 0.0020619583209429 |
| SAOUHSC_02033 | —— | –1.997912806 | 0.0020619829244471 |
| SAOUHSC_01143 | mraW | –0.92140162 | 0.0020889101792461 |
| SAOUHSC_03013 | hisD | 1.2223771327029 | 0.0021092819023411 |
| SAOUHSC_02043 | —— | –2.047810471 | 0.0021556373568047 |
| SAOUHSC_01110 | —— | –1.191676519 | 0.0021873499377511 |
| SAOUHSC_03049 | parB | 0.60332391387197 | 0.0021873499377511 |
| SAOUHSC_01463 | —— | 0.61154665780835 | 0.0021879549668128 |
| SAOUHSC_02036 | —— | –1.998777461 | 0.0022125862846249 |
| SAOUHSC_00808 | —— | –0.649674714 | 0.0022373591356237 |
| SAOUHSC_02069 | —— | –1.765770084 | 0.0023419259587974 |
| SAOUHSC_02846 | ybgC | 0.80122999668078 | 0.0023748537011783 |
| SAOUHSC_01106 | murI | 0.58523606615258 | 0.0023748537011783 |
| SAOUHSC_A00992 | —— | 1.2477118063618 | 0.0023806920233304 |
| SAOUHSC_02020 | —— | –2.49363233 | 0.0023874442585099 |
| SAOUHSC_01819 | —— | –0.982976174 | 0.0024193528251344 |
| SAOUHSC_01795 | coaE | 0.6654033924717 | 0.0024193528251344 |
| SAOUHSC_02025 | —— | –2.381953952 | 0.0024232037293029 |
| SAOUHSC_02844 | —— | 0.63390564132853 | 0.002429287624196 |
| SAOUHSC_02213 | —— | –4.727397307 | 0.0024700139519445 |
| SAOUHSC_02220 | —— | –1.852340329 | 0.0025216349030413 |
| SAOUHSC_02031 | —— | –2.171683494 | 0.0025216349030413 |
| SAOUHSC_01125 | —— | 1.3074574324394 | 0.0025422585716695 |
| SAOUHSC_01139 | —— | 0.83881892594592 | 0.0025753326755103 |
| SAOUHSC_00030 | —— | –1.127832271 | 0.0025756202948722 |
| SAOUHSC_02041 | —— | –2.40185731 | 0.0026147963969672 |
| SAOUHSC_02067 | —— | –1.645873796 | 0.0026316646078852 |
| SAOUHSC_00234 | yydK | –0.806671548 | 0.0026750118839433 |
| SAOUHSC_01769 | —— | 0.88482259521018 | 0.0027038556112162 |
| SAOUHSC_00703 | norA | 1.0179180721354 | 0.0027140282284765 |
| SAOUHSC_02336 | fabZ | –0.721377964 | 0.0027359317815305 |
| SAOUHSC_01903 | crcB | –1.608530414 | 0.002752839602963 |
| SAOUHSC_01049 | potD | 0.61208349081998 | 0.0028438878149747 |
| SAOUHSC_02118 | gatC | –0.69338747 | 0.0028444418302161 |
| SAOUHSC_00774 | —— | –1.374190979 | 0.0028744563553222 |
| SAOUHSC_01331 | —— | –0.81905892 | 0.0028744563553222 |
| SAOUHSC_02072 | —— | –1.738600118 | 0.0028812751534316 |
| SAOUHSC_00467 | purR | –0.855837865 | 0.0029007674816821 |
| SAOUHSC_00026 | —— | –2.071564862 | 0.0029258197560895 |
| SAOUHSC_00304 | —— | –0.692598095 | 0.0029289944580668 |
| SAOUHSC_02761 | —— | –2.0704623 | 0.0029439927122354 |
| SAOUHSC_00164 | —— | –0.940306408 | 0.0030004645194323 |
| SAOUHSC_00888 | mnhB | 0.66183373995377 | 0.0030257243474731 |
| SAOUHSC_00998 | fmtA | –2.054052774 | 0.0030257243474731 |
| SAOUHSC_02656 | —— | 0.90923376537765 | 0.0030548857729542 |
| SAOUHSC_00621 | —— | 0.79462830706806 | 0.0031003211050875 |
| SAOUHSC_00633 | nhaK | 0.77250369549779 | 0.0031998410949685 |
| SAOUHSC_00486 | ftsH | 0.91300031670288 | 0.0032162139554613 |
| SAOUHSC_02886 | —— | –3.122234196 | 0.003257199284888 |
| SAOUHSC_01706 | —— | –1.073627223 | 0.0032688625685905 |
| SAOUHSC_00880 | yuiF | 0.9205825943516 | 0.0033121606814873 |
| SAOUHSC_00277 | —— | –1.545681304 | 0.0033153782403698 |
| SAOUHSC_02078 | —— | –1.799670057 | 0.0033252911324729 |
| SAOUHSC_00002 | dnaN | –0.6866035 | 0.0033252911324729 |
| SAOUHSC_01128 | argF | 1.3135045052554 | 0.0034129253976715 |
| SAOUHSC_00292 | psuG | 1.6284944438813 | 0.0034185524805067 |
| SAOUHSC_01162 | lspA | –2.240996055 | 0.0034273286557622 |
| SAOUHSC_01828 | msrC | 0.67044009730904 | 0.0034293469089293 |
| SAOUHSC_00430 | —— | –0.622882548 | 0.0034293469089293 |
| SAOUHSC_02219 | —— | –2.051027502 | 0.0034315501730998 |
| SAOUHSC_02461 | adhR | 0.80058212963707 | 0.0035042290155656 |
| SAOUHSC_01287 | glnA | –0.826785183 | 0.0035830812396922 |
| SAOUHSC_02035 | —— | –2.046365466 | 0.0036432534766991 |
| SAOUHSC_02301 | rsbU_P | –0.619491533 | 0.0036555416172794 |
| SAOUHSC_01058 | typA | –0.804712608 | 0.0036555786879194 |
| SAOUHSC_01743 | apt | –0.597485456 | 0.0036641446927368 |
| SAOUHSC_02165 | —— | –2.767916474 | 0.0036670270003574 |
| SAOUHSC_02883 | —— | –1.42940779 | 0.0036670270003574 |
| SAOUHSC_02070 | —— | –1.805066927 | 0.0036670270003574 |
| SAOUHSC_00997 | tagT_U_V | 0.67167256809137 | 0.0038350458057047 |
| SAOUHSC_00340 | metC | 1.3625901997113 | 0.0039606836641989 |
| SAOUHSC_01275 | glpF | 0.62846809171942 | 0.0040012377197584 |
| SAOUHSC_00554 | hxlB | 0.64587837902261 | 0.0040744124865834 |
| SAOUHSC_00485 | hprT | –1.126374201 | 0.0040865773138258 |
| SAOUHSC_03015 | —— | 1.4553371245835 | 0.0041305120147514 |
| SAOUHSC_01328 | rpmG | 0.9316342743759 | 0.0041818439957312 |
| SAOUHSC_03017 | —— | 1.4585319479337 | 0.0041894102334576 |
| SAOUHSC_02576 | —— | –1.361949498 | 0.0042513894572127 |
| SAOUHSC_02037 | —— | –2.398017429 | 0.0043179433321735 |
| SAOUHSC_02071 | —— | –1.767268632 | 0.0043179433321735 |
| SAOUHSC_01894 | arsC | 0.78331507512243 | 0.0044068104002757 |
| SAOUHSC_02077 | —— | –2.063058491 | 0.0044111220052988 |
| SAOUHSC_02865 | feoA | 1.6869624154895 | 0.0044209926226937 |
| SAOUHSC_A02794 | —— | 1.1198890595793 | 0.00445463866805 |
| SAOUHSC_02901 | —— | 0.78930792692238 | 0.0045323731294441 |
| SAOUHSC_00961 | comK | –0.845698266 | 0.0045895597652392 |
| SAOUHSC_01285 | glnR | –1.04657752 | 0.0046220726625099 |
| SAOUHSC_02520 | glcU | 0.97661812316038 | 0.0047277242828533 |
| SAOUHSC_02266 | —— | –1.217552675 | 0.0047471354186771 |
| SAOUHSC_02811 | —— | 0.58995412037613 | 0.0047585688143394 |
| SAOUHSC_02607 | hutU | –1.017558718 | 0.0048747346485221 |
| SAOUHSC_01583 | —— | –0.746871354 | 0.0049332249390055 |
| SAOUHSC_02915 | —— | 0.65078906186602 | 0.0049332249390055 |
| SAOUHSC_01653 | —— | 0.63824116707594 | 0.0049584930272531 |
| SAOUHSC_00985 | menB | 0.62367304208472 | 0.0049866370100624 |
| SAOUHSC_02382 | —— | 0.85470184357212 | 0.0051020566099379 |
| SAOUHSC_02021 | —— | –2.117925341 | 0.0051427334325558 |
| SAOUHSC_01401 | lysA | 0.74211151448686 | 0.0051720009329375 |
| SAOUHSC_00721 | queC | –0.646058681 | 0.0052245609904001 |
| SAOUHSC_00521 | rplL | 0.63534358800663 | 0.0052671496592183 |
| SAOUHSC_00020 | vicR | –0.602611873 | 0.0052791642631403 |
| SAOUHSC_02584 | suhB | –0.807555256 | 0.0053451550150805 |
| SAOUHSC_01942 | sspA | –1.718401812 | 0.0054795660500871 |
| SAOUHSC_01209 | rimM | –0.662104365 | 0.0058356456478586 |
| SAOUHSC_02840 | sdaA | –0.759364687 | 0.0058541622760534 |
| SAOUHSC_01621 | nusB | –1.184244123 | 0.005977032082323 |
| SAOUHSC_03025 | pcp | –0.815875676 | 0.005977032082323 |
| SAOUHSC_02374 | —— | 0.66777887389162 | 0.0060789798313242 |
| SAOUHSC_01782 | —— | –0.878481431 | 0.0063862432003403 |
| SAOUHSC_02571 | —— | –1.308199862 | 0.0064144877886339 |
| SAOUHSC_02064 | —— | –1.987468103 | 0.0065921624828931 |
| SAOUHSC_00922 | —— | –4.479563832 | 0.0066299711999501 |
| SAOUHSC_00702 | —— | 0.80601792445282 | 0.0066678216255009 |
| SAOUHSC_01171 | pyrF | 1.3445535459886 | 0.006678555882225 |
| SAOUHSC_02160 | —— | –1.158218526 | 0.006748464690346 |
| SAOUHSC_00341 | metB | 1.389863503 | 0.006748464690346 |
| SAOUHSC_02447 | qorA | 0.64354020296423 | 0.0067592054236916 |
| SAOUHSC_02062 | —— | –1.912510713 | 0.0067592054236916 |
| SAOUHSC_02764 | nikD | 0.83669903786048 | 0.0069761463078693 |
| SAOUHSC_02876 | —— | 0.70936811682049 | 0.0069887472897586 |
| SAOUHSC_02900 | —— | 0.60388828316752 | 0.0070635368946344 |
| SAOUHSC_01610 | brxA_B | 0.64386264288618 | 0.0071157674034216 |
| SAOUHSC_02110 | dnaQ | –0.934038331 | 0.0071622576754662 |
| SAOUHSC_00293 | —— | 1.2966437543388 | 0.0072781686272241 |
| SAOUHSC_00278 | —— | –1.045640003 | 0.0073046602293607 |
| SAOUHSC_00497 | —— | –1.342302913 | 0.0073480264030009 |
| SAOUHSC_01240 | proS | 0.6338658931313 | 0.0074425607405437 |
| SAOUHSC_00033 | —— | 1.1582774193079 | 0.0075178883434295 |
| SAOUHSC_02875 | ldhA | 0.83166819624266 | 0.0076705578289656 |
| SAOUHSC_02034 | —— | –2.221466947 | 0.007697048339239 |
| SAOUHSC_00276 | —— | –1.13763954 | 0.0079589409661745 |
| SAOUHSC_01763 | radC | –1.20759201 | 0.0079589409661745 |
| SAOUHSC_01244 | ylxR | –1.129970199 | 0.0080659189271986 |
| SAOUHSC_00328 | tatC | 1.0496802049216 | 0.0087124776104806 |
| SAOUHSC_00500 | pdxT | –0.589171955 | 0.0088755166528908 |
| SAOUHSC_02949 | gpx | 0.99073525800369 | 0.0090405784479339 |
| SAOUHSC_02073 | —— | –1.638965196 | 0.0092411823302322 |
| SAOUHSC_02897 | —— | 1.1397598129142 | 0.00931164592645 |
| SAOUHSC_03018 | ecfT | 1.0922757016477 | 0.0095995843691039 |
| SAOUHSC_02027 | —— | –2.353189502 | 0.0096563965404817 |
| SAOUHSC_01030 | —— | –3.73314688 | 0.0096695104186138 |
| SAOUHSC_01781 | —— | –1.047071461 | 0.0097607751692821 |
| SAOUHSC_00456 | —— | –0.989794737 | 0.0097607751692821 |
| SAOUHSC_00257 | —— | 0.78856843255081 | 0.0098363964043739 |
| SAOUHSC_00759 | —— | –0.780757398 | 0.0098707589123868 |
| SAOUHSC_02057 | dut | –1.6666671 | 0.010160846107577 |
| SAOUHSC_02040 | —— | –2.338255248 | 0.010195687273837 |
| SAOUHSC_00685 | —— | –0.92079888 | 0.010195687273837 |
| SAOUHSC_03036 | bceA | 1.2897255620959 | 0.010306566031115 |
| SAOUHSC_01477 | —— | 0.71568498720982 | 0.010592304436582 |
| SAOUHSC_01957 | —— | –1.018068389 | 0.010722614562693 |
| SAOUHSC_02038 | —— | –2.241425924 | 0.010802601740402 |
| SAOUHSC_02668 | —— | –1.927765699 | 0.010876338829062 |
| SAOUHSC_01503 | —— | –1.358891696 | 0.011037836690343 |
| SAOUHSC_00240 | rbsD | –1.220502194 | 0.011080796268671 |
| SAOUHSC_01831 | —— | 0.84395182797049 | 0.011111467113258 |
| SAOUHSC_03014 | hisG | 1.9069301181117 | 0.011160036255582 |
| SAOUHSC_00982 | menF | –0.712925358 | 0.011195551606572 |
| SAOUHSC_01993 | —— | –0.70254634 | 0.011822583869766 |
| SAOUHSC_00133 | czcD | 0.76824217142944 | 0.012126326245485 |
| SAOUHSC_02231 | antB | –2.546762756 | 0.012649778843239 |
| SAOUHSC_02331 | tenA | –1.035350883 | 0.012702593246921 |
| SAOUHSC_00314 | mepR | –0.808216141 | 0.01311543692801 |
| SAOUHSC_00773 | —— | 0.71046901333826 | 0.013185667059945 |
| SAOUHSC_00437 | treB | –0.60051953 | 0.013239098115493 |
| SAOUHSC_03037 | bceB | 0.94331998875374 | 0.013521640778145 |
| SAOUHSC_01817 | —— | –0.67490636 | 0.013948221209387 |
| SAOUHSC_02678 | narI | –0.934165271 | 0.014137526451544 |
| SAOUHSC_01917 | —— | –1.289428329 | 0.014280909384703 |
| SAOUHSC_02552 | bioY | –0.821563635 | 0.014280909384703 |
| SAOUHSC_02619 | —— | –0.598791679 | 0.014280909384703 |
| SAOUHSC_03051 | gidB | 0.82616980364886 | 0.014594621917999 |
| SAOUHSC_02499 | rpsN | 0.93480935080282 | 0.014824171705504 |
| SAOUHSC_01514 | —— | –0.768358006 | 0.014824171705504 |
| SAOUHSC_01133 | eta | 0.62254877895523 | 0.014884925782494 |
| SAOUHSC_03006 | lip | 0.59862781209824 | 0.015153483468352 |
| SAOUHSC_02726 | —— | –1.414877827 | 0.015400230501069 |
| SAOUHSC_01172 | pyrE | 1.4485552514404 | 0.015439887227896 |
| SAOUHSC_01288 | —— | –3.811558843 | 0.016115454855777 |
| SAOUHSC_01576 | —— | –0.681273254 | 0.016115454855777 |
| SAOUHSC_02019 | xlyAB | –2.428175486 | 0.01612238531556 |
| SAOUHSC_00802 | yvaK | 0.63689807800653 | 0.01612238531556 |
| SAOUHSC_01488 | hepS | –0.783797744 | 0.016412859263351 |
| SAOUHSC_00458 | —— | –1.707699522 | 0.016461056548549 |
| SAOUHSC_00618 | —— | –1.791238215 | 0.016553453142204 |
| SAOUHSC_02234 | —— | –2.294171268 | 0.016553453142204 |
| SAOUHSC_00637 | mntA | –1.096694179 | 0.016554150402918 |
| SAOUHSC_03028 | —— | –0.764135035 | 0.016565364123822 |
| SAOUHSC_00057 | —— | 0.88368145929234 | 0.01677086480271 |
| SAOUHSC_00189 | —— | 1.6421901651112 | 0.016787223992936 |
| SAOUHSC_03035 | —— | –0.792229734 | 0.016915236705438 |
| SAOUHSC_00988 | sspA | –1.113842934 | 0.01693711641294 |
| SAOUHSC_01655 | zurR | –2.142322434 | 0.017281391479078 |
| SAOUHSC_02904 | —— | 0.81941440036121 | 0.017305710995056 |
| SAOUHSC_01675 | —— | 0.62274591374192 | 0.017525413278337 |
| SAOUHSC_00219 | gutB | 0.81685336238164 | 0.017558072319894 |
| SAOUHSC_00991 | —— | 1.5492755731708 | 0.017756254040996 |
| SAOUHSC_00885 | mnhE | 0.77106731700468 | 0.017799281818091 |
| SAOUHSC_00714 | saeS | –0.802403662 | 0.017799281818091 |
| SAOUHSC_01941 | —— | –1.108121536 | 0.017917177484678 |
| SAOUHSC_01371 | trpB | 1.0463813044694 | 0.018046854668778 |
| SAOUHSC_02059 | —— | –1.919774394 | 0.01833530407392 |
| SAOUHSC_00864 | —— | –0.590829132 | 0.018700527162911 |
| SAOUHSC_01921 | —— | –0.933011111 | 0.018780566077746 |
| SAOUHSC_01898 | —— | –2.886413754 | 0.018909843138357 |
| SAOUHSC_02810 | —— | 0.69556715264434 | 0.019339543322982 |
| SAOUHSC_02719 | irtA | –0.843680739 | 0.019664570813431 |
| SAOUHSC_02330 | thiD | –0.6352309 | 0.019760391586309 |
| SAOUHSC_00817 | —— | –1.019178659 | 0.019782519389654 |
| SAOUHSC_00910 | —— | 0.72096540452579 | 0.019788954124306 |
| SAOUHSC_02089 | —— | –0.60519946 | 0.019944072934845 |
| SAOUHSC_01947 | nisE | 0.7920470992125 | 0.01995894406506 |
| SAOUHSC_01121 | hlyII | –0.817904037 | 0.01995894406506 |
| SAOUHSC_00754 | —— | –0.650081172 | 0.01995894406506 |
| SAOUHSC_02992 | —— | –2.164039064 | 0.020319566104393 |
| SAOUHSC_01369 | trpC | 1.4035152860616 | 0.020351943118331 |
| SAOUHSC_00235 | bglFa | –1.369292544 | 0.020396018194299 |
| SAOUHSC_00420 | —— | –1.122740258 | 0.020552393241354 |
| SAOUHSC_02690 | znuA | –0.61035693 | 0.020708243788875 |
| SAOUHSC_01015 | purM | 1.1636930933983 | 0.020731331400775 |
| SAOUHSC_02419 | —— | 0.58909533867652 | 0.021636529245219 |
| SAOUHSC_01794 | gap2 | 0.68396952449671 | 0.02172620353758 |
| SAOUHSC_01103 | sdhC | –0.727491925 | 0.021756547247796 |
| SAOUHSC_00290 | —— | 0.8219523271376 | 0.021796927685927 |
| SAOUHSC_00835 | —— | –1.113660632 | 0.022193041294005 |
| SAOUHSC_02570 | —— | –1.299696787 | 0.022314436575171 |
| SAOUHSC_01801 | icd | 0.67962843226194 | 0.022646109278031 |
| SAOUHSC_00200 | prsW | –0.782594547 | 0.022712450520361 |
| SAOUHSC_00968 | —— | 1.4505852401509 | 0.022717473647869 |
| SAOUHSC_00917 | —— | –1.022112177 | 0.022728414685576 |
| SAOUHSC_02214 | —— | –2.051067494 | 0.022728414685576 |
| SAOUHSC_00236 | bglA | –1.094736877 | 0.023018990592238 |
| SAOUHSC_00381 | —— | 0.80817478299318 | 0.023083676952628 |
| SAOUHSC_02226 | —— | –0.648660799 | 0.023231021880529 |
| SAOUHSC_02321 | —— | –0.787418672 | 0.023389922685032 |
| SAOUHSC_00330 | —— | 0.87540008434038 | 0.023470849623577 |
| SAOUHSC_02200 | —— | –1.498617675 | 0.023937644875101 |
| SAOUHSC_00400 | —— | –0.733413822 | 0.02464927384671 |
| SAOUHSC_01142 | mraZ | –0.591609247 | 0.024976672266058 |
| SAOUHSC_02356 | ywlE | –0.687664984 | 0.025108804486314 |
| SAOUHSC_02208 | —— | –3.432304387 | 0.025506058170281 |
| SAOUHSC_01084 | isdD | –1.521630927 | 0.02559822346451 |
| SAOUHSC_02968 | argF | –0.594132946 | 0.02559822346451 |
| SAOUHSC_02845 | —— | 0.58760898598977 | 0.02559822346451 |
| SAOUHSC_01073 | —— | –2.658102428 | 0.025738732937882 |
| SAOUHSC_01922 | —— | –0.585532734 | 0.026223190510839 |
| SAOUHSC_00556 | proP | 0.66582800506652 | 0.026228682551156 |
| SAOUHSC_02075 | —— | –1.831556007 | 0.026228682551156 |
| SAOUHSC_01978 | —— | –0.672911165 | 0.026228682551156 |
| SAOUHSC_00172 | —— | –0.895757576 | 0.026343047648901 |
| SAOUHSC_01990 | artR | 0.77571150290138 | 0.026580049292468 |
| SAOUHSC_01788 | thrS | 1.2084533711837 | 0.026580049292468 |
| SAOUHSC_01156 | —— | –1.094586239 | 0.026703816528002 |
| SAOUHSC_01908 | —— | –0.887743226 | 0.027235671721787 |
| SAOUHSC_00924 | oppC | 0.71416719290612 | 0.027362594148431 |
| SAOUHSC_01951 | lanC | 0.73303673235637 | 0.02744948624009 |
| SAOUHSC_00722 | pabA | –0.749109024 | 0.027707183082912 |
| SAOUHSC_02505 | rplP | 0.61027690113075 | 0.027778476636522 |
| SAOUHSC_01075 | coaD | –1.21604125 | 0.027778476636522 |
| SAOUHSC_00197 | gcdH | 1.3511315123024 | 0.027910205167571 |
| SAOUHSC_02051 | —— | –1.394658778 | 0.027947341540468 |
| SAOUHSC_00914 | leuA | –1.580240171 | 0.028080401010494 |
| SAOUHSC_00844 | metQ | 0.64713778171343 | 0.028125838898049 |
| SAOUHSC_02074 | —— | –1.636387491 | 0.028727128522949 |
| SAOUHSC_01082 | isdC | –0.98204651 | 0.029317929795204 |
| SAOUHSC_02435 | sfaA | –0.71122261 | 0.029342268920983 |
| SAOUHSC_01088 | srtB | –5.316863077 | 0.029501775321837 |
| SAOUHSC_02516 | pbuG | 0.71269108372256 | 0.030592856350289 |
| SAOUHSC_00800 | —— | –2.001992937 | 0.030725480875481 |
| SAOUHSC_01850 | galR | 0.66555935381399 | 0.030817339103509 |
| SAOUHSC_02112 | —— | 0.77381824861303 | 0.030836171666649 |
| SAOUHSC_01219 | —— | 0.92522580762865 | 0.031148481668371 |
| SAOUHSC_00399 | ssl5_11 | –2.410327088 | 0.031422708759731 |
| SAOUHSC_02065 | —— | –2.380595453 | 0.032498925792418 |
| SAOUHSC_00317 | glpT | 0.62569165242052 | 0.032941768953837 |
| SAOUHSC_02068 | —— | –2.15852698 | 0.033051950980293 |
| SAOUHSC_00274 | —— | –0.845877289 | 0.033302246976629 |
| SAOUHSC_00324 | rimL | 0.6134723542689 | 0.033364274193339 |
| SAOUHSC_01648 | gluP | –0.613245004 | 0.033397443271174 |
| SAOUHSC_02028 | —— | –2.334725371 | 0.03340289794433 |
| SAOUHSC_02928 | —— | –1.500885309 | 0.033595581090793 |
| SAOUHSC_00413 | —— | 0.83148543937748 | 0.03366637493725 |
| SAOUHSC_00291 | —— | 1.2267083146962 | 0.034792509597878 |
| SAOUHSC_00231 | lytT | –1.102540385 | 0.035049535719849 |
| SAOUHSC_00046 | —— | –1.344194364 | 0.035688333783466 |
| SAOUHSC_01127 | —— | 0.95576199180297 | 0.035781257672372 |
| SAOUHSC_02624 | corA | –0.890165069 | 0.036900148741509 |
| SAOUHSC_01865 | trmB | –1.080483324 | 0.037001971094812 |
| SAOUHSC_00767 | hpf | 0.73421655831958 | 0.037038824211683 |
| SAOUHSC_01372 | trpA | 0.58741718354951 | 0.037133815178602 |
| SAOUHSC_02515 | —— | 0.81440129475115 | 0.037743187025494 |
| SAOUHSC_02797 | —— | 0.71691343217282 | 0.037743187025494 |
| SAOUHSC_00874 | —— | –0.626876421 | 0.038113902175906 |
| SAOUHSC_02587 | —— | –1.224423251 | 0.038507486793224 |
| SAOUHSC_02765 | nikC | 0.86440182121816 | 0.038507486793224 |
| SAOUHSC_00275 | —— | –0.738345374 | 0.038637163371045 |
| SAOUHSC_01633 | gcvPA | 0.62302864618816 | 0.038765456188092 |
| SAOUHSC_00372 | xpt | –0.713148211 | 0.03903068189068 |
| SAOUHSC_01370 | trpF | 1.4592492213281 | 0.039306378844032 |
| SAOUHSC_01937 | —— | –0.915509379 | 0.03944426085136 |
| SAOUHSC_02029 | —— | –2.092439802 | 0.040850624414348 |
| SAOUHSC_00105 | phnD | 0.89801583083249 | 0.041383792003912 |
| SAOUHSC_01366 | trpE | 0.80855226762425 | 0.041762390259527 |
| SAOUHSC_01835 | —— | 0.61356041531184 | 0.041777560547371 |
| SAOUHSC_02458 | —— | 2.6135966103724 | 0.042021968658579 |
| SAOUHSC_02252 | —— | –1.638597981 | 0.042183875407435 |
| SAOUHSC_02044 | —— | –2.181670095 | 0.043006709194574 |
| SAOUHSC_01356 | glcT | –1.774651755 | 0.043006709194574 |
| SAOUHSC_01897 | —— | –3.307109832 | 0.043020861470809 |
| SAOUHSC_01459 | —— | –0.926396263 | 0.043410349846806 |
| SAOUHSC_02322 | csoR | –0.858567723 | 0.043511969837176 |
| SAOUHSC_01378 | ddpD | 0.63725425377979 | 0.043824588674862 |
| SAOUHSC_01099 | mutS2 | 0.69245974688545 | 0.044421941619702 |
| SAOUHSC_02247 | trkH | 0.70303376648886 | 0.044947637541578 |
| SAOUHSC_00434 | —— | –0.819805953 | 0.045006276167895 |
| SAOUHSC_00683 | —— | –0.825906728 | 0.045129921203236 |
| SAOUHSC_01913 | mutT | –0.777321485 | 0.046386603751358 |
| SAOUHSC_01793 | nrdR | –0.612008268 | 0.046426970666057 |
| SAOUHSC_02691 | yoeB | –0.594867707 | 0.046498333465394 |
| SAOUHSC_02042 | —— | –2.454906082 | 0.047088456586072 |
| SAOUHSC_02757 | yefM | –0.839603444 | 0.047088456586072 |
| SAOUHSC_02605 | —— | 0.5906714171664 | 0.047412460696636 |
| SAOUHSC_00883 | mnhG | 0.87879839887552 | 0.047434326625915 |
| SAOUHSC_02595 | —— | 0.71073654951822 | 0.048492120110149 |
| SAOUHSC_03001 | icaR | 0.58794364632224 | 0.38304719349524 |
Table S3. The DEGs of biofilm in CEO treatment group and control group of S. aureus NCTC8325.
| gene_id | gene_name | log2(FC) | p.adjust |
|---|---|---|---|
| SAOUHSC_02098 | vraR | 3.9374037182547 | 4.4053908843041E-75 |
| SAOUHSC_02706 | sbi | –5.213040911 | 8.5347228015132E-67 |
| SAOUHSC_02709 | hlg | –4.536629128 | 1.1001718397565E-57 |
| SAOUHSC_01945 | epiG | 2.3856611773368 | 9.3865964000736E-48 |
| SAOUHSC_02708 | hlg | –5.417785399 | 2.9177305992439E-47 |
| SAOUHSC_00315 | mepA | 3.2726302471581 | 7.287557965092E-41 |
| SAOUHSC_02100 | —— | 3.2345833271841 | 4.1131874036001E-40 |
| SAOUHSC_02710 | hlg | –3.591125574 | 1.156056265482E-39 |
| SAOUHSC_01114 | fib | –3.992813112 | 2.3896505423458E-37 |
| SAOUHSC_00061 | ohyA | 2.2800503031939 | 4.0588100300953E-35 |
| SAOUHSC_01115 | scn | –4.348960126 | 1.3660693556107E-31 |
| SAOUHSC_02099 | vraS | 3.4856761228027 | 6.0504217810581E-30 |
| SAOUHSC_02113 | rumA | 2.1659249503749 | 1.392742775099E-29 |
| SAOUHSC_01005 | —— | 2.7164693954846 | 7.031376011763E-29 |
| SAOUHSC_00316 | —— | 2.8992925351583 | 7.6654497381478E-29 |
| SAOUHSC_02243 | hlg | –3.078258946 | 1.6638422814717E-28 |
| SAOUHSC_00069 | spa | –5.106197015 | 2.689345432167E-28 |
| SAOUHSC_01949 | nisP | 2.510151239 | 6.1839651746842E-28 |
| SAOUHSC_02923 | —— | 2.4999299325916 | 3.22437925072E-26 |
| SAOUHSC_03027 | —— | 3.1296218016411 | 4.0360601394081E-26 |
| SAOUHSC_02820 | —— | –2.883015132 | 7.2722327627275E-26 |
| SAOUHSC_02873 | copA | 1.8152345124073 | 2.0593086180334E-25 |
| SAOUHSC_02590 | —— | 1.8012505270384 | 1.0756753445208E-24 |
| SAOUHSC_00192 | —— | –4.095993548 | 1.2775501030963E-24 |
| SAOUHSC_00582 | —— | 2.1547205404715 | 6.8000628002177E-23 |
| SAOUHSC_02723 | glxK | 2.9933574843418 | 1.5846775952864E-22 |
| SAOUHSC_01110 | —— | –3.994650645 | 1.7654230990679E-22 |
| SAOUHSC_02724 | —— | 3.2143627345239 | 1.7932116835135E-22 |
| SAOUHSC_01951 | lanC | 2.4827983540666 | 2.1118603700622E-22 |
| SAOUHSC_02241 | hlg | –2.567499508 | 3.3998710389763E-22 |
| SAOUHSC_02012 | sgtB | 2.6495588281258 | 5.504400310581E-22 |
| SAOUHSC_00812 | clfA | 1.945657518 | 9.2996394670839E-22 |
| SAOUHSC_00898 | argH | 2.6531564473172 | 1.0865265180626E-21 |
| SAOUHSC_02814 | —— | 1.5614820429818 | 1.5847544497922E-21 |
| SAOUHSC_00427 | sle1 | –3.706132685 | 4.4737090333122E-21 |
| SAOUHSC_00581 | rclA | 1.8330014067219 | 8.7450956409074E-21 |
| SAOUHSC_02813 | —— | 1.5694862604008 | 1.0844011136282E-20 |
| SAOUHSC_00639 | —— | 2.7083360949173 | 1.3796355896666E-20 |
| SAOUHSC_01121 | hlyII | –3.163262093 | 4.1278559272817E-20 |
| SAOUHSC_02583 | tagT_U_V | 1.989213243 | 6.5756273076215E-20 |
| SAOUHSC_00181 | —— | 2.0549602192638 | 2.6237063266222E-18 |
| SAOUHSC_02646 | —— | 2.6886622489321 | 2.732842479236E-17 |
| SAOUHSC_00717 | —— | –3.133467416 | 4.2211351770758E-17 |
| SAOUHSC_01394 | lysC | 1.8606568122063 | 9.6050141941305E-17 |
| SAOUHSC_00180 | —— | 2.476707528 | 3.6401345919423E-16 |
| SAOUHSC_01467 | mrcA | 1.5334735732349 | 4.0499896226988E-16 |
| SAOUHSC_02365 | murA | 1.772700211 | 4.6790009774352E-16 |
| SAOUHSC_02769 | cntL | –2.922006235 | 4.9648240231929E-16 |
| SAOUHSC_00300 | lip | –1.835900189 | 6.3832759781087E-16 |
| SAOUHSC_00191 | scn | –3.228831152 | 1.0545783290599E-15 |
| SAOUHSC_00632 | mnhG | 1.6279943702565 | 1.4172602129146E-15 |
| SAOUHSC_02830 | ldhA | 2.078671669 | 1.8086687441056E-15 |
| SAOUHSC_02872 | —— | 3.0171972170139 | 1.9053040007786E-15 |
| SAOUHSC_01952 | lanB | 2.3696686262793 | 1.0801977881831E-14 |
| SAOUHSC_00899 | argG | 2.2531079957046 | 1.3814085992537E-14 |
| SAOUHSC_03021 | —— | 2.4990157181246 | 5.6645863747289E-14 |
| SAOUHSC_01287 | glnA | –1.973007957 | 6.8262702824545E-14 |
| SAOUHSC_01235 | pyrH | –1.622427785 | 7.5330589536703E-14 |
| SAOUHSC_00262 | ftsK | 1.4680535193866 | 1.1169830218236E-13 |
| SAOUHSC_01947 | nisE | 1.9850771999154 | 1.9941053624116E-13 |
| SAOUHSC_01159 | ileS | –1.336976782 | 2.4016347824858E-13 |
| SAOUHSC_00060 | yjbB | –2.122947995 | 3.2932235863704E-13 |
| SAOUHSC_00179 | —— | 1.915303136 | 8.8271522289805E-13 |
| SAOUHSC_02155 | —— | 1.4049943682858 | 9.9010597924038E-13 |
| SAOUHSC_00901 | —— | 1.7141883255032 | 1.0376131388839E-12 |
| SAOUHSC_00671 | —— | –2.654939004 | 1.0726104945641E-12 |
| SAOUHSC_01395 | asd | 1.3634700199542 | 1.2611885080021E-12 |
| SAOUHSC_00992 | —— | 1.4884990656545 | 1.2628301379701E-12 |
| SAOUHSC_02112 | —— | 2.2348462421978 | 2.3391290175654E-12 |
| SAOUHSC_00715 | saeR | –2.056845531 | 2.5415552438217E-12 |
| SAOUHSC_01361 | tagT_U_V | 1.9941883418198 | 4.3773843746001E-12 |
| SAOUHSC_01236 | frr | –1.156739601 | 6.6521674015585E-12 |
| SAOUHSC_02983 | —— | 1.1737309199208 | 7.6685307782022E-12 |
| SAOUHSC_03019 | ecfA | 1.8196733869538 | 8.2805192936608E-12 |
| SAOUHSC_03023 | drp35 | 1.5547162353652 | 1.5202075104145E-11 |
| SAOUHSC_02154 | —— | 1.4546261528879 | 2.0935769076279E-11 |
| SAOUHSC_02888 | —— | 1.7197381487406 | 2.0935769076279E-11 |
| SAOUHSC_01285 | glnR | –2.458041012 | 6.5130804581423E-11 |
| SAOUHSC_02770 | cntK | –2.913194292 | 6.9268784682736E-11 |
| SAOUHSC_02093 | —— | 2.3418829752262 | 8.7465718286272E-11 |
| SAOUHSC_01234 | tsf | –1.052984368 | 9.2048704792231E-11 |
| SAOUHSC_02690 | znuA | –1.708566962 | 9.4765606236707E-11 |
| SAOUHSC_00716 | doxD | –2.378330956 | 1.054707727294E-10 |
| SAOUHSC_00994 | atl | –2.176446311 | 1.2698108474831E-10 |
| SAOUHSC_00902 | lepB | 1.4805414008578 | 1.5122822504468E-10 |
| SAOUHSC_02984 | —— | 1.1790533570618 | 1.9556516592895E-10 |
| SAOUHSC_01910 | pckA | 1.1108510168201 | 2.3869825982385E-10 |
| SAOUHSC_03020 | mtsT | 2.0863890974275 | 2.7108997577069E-10 |
| SAOUHSC_02768 | cntM | –2.375880345 | 4.4547010223403E-10 |
| SAOUHSC_02562 | ureE | 1.7796438611182 | 5.4706037141027E-10 |
| SAOUHSC_02565 | ureD | 1.5924025851041 | 7.3904900823087E-10 |
| SAOUHSC_00233 | lrgB | –2.938257402 | 7.8381032144616E-10 |
| SAOUHSC_01735 | tcdA | –1.058446079 | 1.1658320821148E-9 |
| SAOUHSC_02576 | —— | –2.73094894 | 1.2671757067547E-9 |
| SAOUHSC_00691 | bacA | 1.2989085194526 | 1.7789582408379E-9 |
| SAOUHSC_00178 | ganQ | 1.565821082 | 2.1478812978615E-9 |
| SAOUHSC_01017 | purH | 1.6751372057562 | 2.4496270255871E-9 |
| SAOUHSC_01447 | —— | 0.90238270930059 | 2.759812200409E-9 |
| SAOUHSC_02988 | asp1 | 1.3673320972872 | 3.1237861379128E-9 |
| SAOUHSC_00818 | nuc | –2.43223269 | 3.4053300384607E-9 |
| SAOUHSC_02828 | catE | 1.5537485683586 | 4.5027935533041E-9 |
| SAOUHSC_00259 | —— | 1.3565317150133 | 5.9897677389357E-9 |
| SAOUHSC_01396 | dapA | 1.6205298180776 | 6.3292547333028E-9 |
| SAOUHSC_02705 | —— | –1.548767516 | 6.8790692235266E-9 |
| SAOUHSC_02829 | —— | 1.220804377 | 7.2868121690923E-9 |
| SAOUHSC_01018 | purD | 1.3797188923761 | 7.7188886765434E-9 |
| SAOUHSC_02563 | ureF | 1.7415866051874 | 7.7188886765434E-9 |
| SAOUHSC_00714 | saeS | –1.923105192 | 8.4264071067202E-9 |
| SAOUHSC_02811 | —— | 1.2105771596579 | 8.4264071067202E-9 |
| SAOUHSC_02561 | ureC | 1.8747925344713 | 9.1264154867342E-9 |
| SAOUHSC_01920 | —— | –1.738876773 | 1.3174196548863E-8 |
| SAOUHSC_02924 | puuE | 1.8543230957225 | 1.3446246677737E-8 |
| SAOUHSC_01760 | —— | 3.6786328453216 | 1.7288749734182E-8 |
| SAOUHSC_02990 | —— | 1.1269796619213 | 2.5472391072666E-8 |
| SAOUHSC_01681 | prmA | 1.1588141209763 | 4.4354468958026E-8 |
| SAOUHSC_01320 | hom | 1.333950489 | 6.6014037050403E-8 |
| SAOUHSC_01397 | dapB | 1.4562425854909 | 1.1221123400686E-7 |
| SAOUHSC_01794 | gap2 | 1.7730395868373 | 1.1221123400686E-7 |
| SAOUHSC_02564 | ureG | 1.606132928 | 1.1986464722427E-7 |
| SAOUHSC_02862 | clpL | 0.83899273670073 | 1.2471065140381E-7 |
| SAOUHSC_01275 | glpF | 1.2611439331926 | 1.290485890511E-7 |
| SAOUHSC_00939 | glbN | 1.3882997445526 | 1.608083257144E-7 |
| SAOUHSC_02163 | —— | –3.094146165 | 1.8621227302597E-7 |
| SAOUHSC_02152 | —— | 1.1640113842931 | 1.8621227302597E-7 |
| SAOUHSC_00167 | ddpD | 1.5316006204867 | 2.1764261729609E-7 |
| SAOUHSC_00025 | —— | –1.021173794 | 2.2926323843939E-7 |
| SAOUHSC_02864 | feoB | 1.319494744 | 2.4603667260399E-7 |
| SAOUHSC_00119 | wbjC | 1.1399860730821 | 2.8960430176039E-7 |
| SAOUHSC_02259 | yafV | 0.83951248445074 | 3.0681771264401E-7 |
| SAOUHSC_02161 | eap | –1.48463818 | 3.4177909030525E-7 |
| SAOUHSC_02269 | scrR | –0.9677133 | 4.4870474575281E-7 |
| SAOUHSC_01953 | nisA | 2.5868205680326 | 5.5167342737171E-7 |
| SAOUHSC_01321 | thrC | 1.2976715029471 | 6.5319918705695E-7 |
| SAOUHSC_02558 | ureA | 2.4208523850594 | 6.5319918705695E-7 |
| SAOUHSC_02874 | copZ | 1.8969565179767 | 6.616205561335E-7 |
| SAOUHSC_01016 | purN | 1.582302909 | 8.2805830401518E-7 |
| SAOUHSC_01432 | msrA | 0.89919939901938 | 8.9136814348057E-7 |
| SAOUHSC_02855 | —— | –3.222439096 | 9.0524333439163E-7 |
| SAOUHSC_00120 | wbjD | 1.1668900909837 | 1.0095021626419E-6 |
| SAOUHSC_01165 | K02824 | uraA | 1.1094989681431E-6 |
| SAOUHSC_02887 | —— | —— | 1.4263718080019E-6 |
| SAOUHSC_02907 | —— | —— | 1.535352389973E-6 |
| SAOUHSC_00882 | —— | —— | 1.5991575146485E-6 |
| SAOUHSC_02611 | —— | —— | 1.8951500583217E-6 |
| SAOUHSC_01431 | K07305 | msrB | 1.8997811415801E-6 |
| SAOUHSC_02987 | K12269 | asp2 | 1.9372599051107E-6 |
| SAOUHSC_00422 | K17217 | mccB | 2.0358246199614E-6 |
| SAOUHSC_02669 | K23775 | ohrR | 2.5950561521113E-6 |
| SAOUHSC_01266 | K00174 | korA | 2.8803535251384E-6 |
| SAOUHSC_02731 | K24163 | nhaK | 2.9557676889613E-6 |
| SAOUHSC_01135 | K20337 | psmB | 2.9748543683139E-6 |
| SAOUHSC_02985 | K03070 | secA | 3.2701230585736E-6 |
| SAOUHSC_01918 | —— | —— | 3.4574266882087E-6 |
| SAOUHSC_02557 | K08717 | utp | 3.4741444109468E-6 |
| SAOUHSC_01993 | K07485 | —— | 3.6066359654912E-6 |
| SAOUHSC_01319 | K00928 | lysC | 4.201752644502E-6 |
| SAOUHSC_02729 | K11737 | cycA | 4.3825779687227E-6 |
| SAOUHSC_02101 | —— | —— | 4.4827164034641E-6 |
| SAOUHSC_02244 | K01439 | dapE | 4.555264248543E-6 |
| SAOUHSC_01164 | K02825 | pyrR | 4.6563620701036E-6 |
| SAOUHSC_01584 | —— | —— | 5.026178917118E-6 |
| SAOUHSC_02986 | K12270 | asp3 | 5.2736658509925E-6 |
| SAOUHSC_02867 | —— | —— | 5.3642208970152E-6 |
| SAOUHSC_01430 | K02777 | crr | 5.4913672855992E-6 |
| SAOUHSC_00579 | K00938 | mvaK2 | 5.586856752162E-6 |
| SAOUHSC_02906 | —— | —— | 6.1730466845622E-6 |
| SAOUHSC_00177 | K15771 | ganP | 6.4662018078283E-6 |
| SAOUHSC_02750 | —— | —— | 7.6816542045826E-6 |
| SAOUHSC_02696 | —— | —— | 8.0852555345627E-6 |
| SAOUHSC_00056 | —— | —— | 8.9587273059529E-6 |
| SAOUHSC_02559 | K01429 | ureB | 9.4575866534518E-6 |
| SAOUHSC_00118 | K15894 | pseB | 1.0193478134913E-5 |
| SAOUHSC_00246 | —— | —— | 1.0786181100961E-5 |
| SAOUHSC_00544 | K14194 | sdrC_D_E | 1.1027342428395E-5 |
| SAOUHSC_00323 | —— | —— | 1.1749978434396E-5 |
| SAOUHSC_00421 | K17216 | mccA | 1.2244833442702E-5 |
| SAOUHSC_02967 | K03758 | arcD | 1.3703320503854E-5 |
| SAOUHSC_00319 | —— | —— | 1.3763313368142E-5 |
| SAOUHSC_00174 | lytH | 1.6244597407889 | 1.5541085090437E-5 |
| SAOUHSC_00700 | —— | 1.4520911961235 | 1.7081973530286E-5 |
| SAOUHSC_02883 | —— | –2.075625345 | 1.8361585491648E-5 |
| SAOUHSC_00117 | wbpM | 0.85915221669567 | 1.9836568383933E-5 |
| SAOUHSC_02658 | —— | 1.3295834619503 | 2.2078803336665E-5 |
| SAOUHSC_00217 | gutB | 1.4332681430091 | 2.4122518903769E-5 |
| SAOUHSC_00938 | —— | 1.0049661449637 | 2.413963914016E-5 |
| SAOUHSC_02083 | —— | –2.073990281 | 2.5090783946886E-5 |
| SAOUHSC_00572 | —— | 0.88396202972366 | 2.6427628731007E-5 |
| SAOUHSC_01759 | mreC | 0.81859620567743 | 2.6740703182172E-5 |
| SAOUHSC_00241 | rbsU | –1.006635487 | 2.7336692610496E-5 |
| SAOUHSC_02402 | cmtB | 1.419015253 | 2.9245875990099E-5 |
| SAOUHSC_01416 | sucB | 0.80424567542452 | 3.0581874091126E-5 |
| SAOUHSC_02265 | agrA | –1.02839374 | 3.441021787863E-5 |
| SAOUHSC_00341 | metB | 2.0423969647293 | 3.4704104042037E-5 |
| SAOUHSC_01469 | nth | –0.755667634 | 3.4704104042037E-5 |
| SAOUHSC_02635 | tcaA | 1.5867096869989 | 3.6312009342976E-5 |
| SAOUHSC_02403 | mtlD | 1.2694521421659 | 3.6899726221779E-5 |
| SAOUHSC_00584 | —— | 0.72501360103379 | 3.7068481138674E-5 |
| SAOUHSC_01113 | —— | –2.744538658 | 3.7331645928566E-5 |
| SAOUHSC_01813 | —— | –0.676938301 | 3.743865763479E-5 |
| SAOUHSC_02812 | —— | 1.0092091660551 | 3.8837291032656E-5 |
| SAOUHSC_02772 | —— | 0.93308190539749 | 4.2343532699327E-5 |
| SAOUHSC_01276 | glpK | 0.97606784371589 | 4.3745586837103E-5 |
| SAOUHSC_02911 | queH | –1.006968396 | 4.5200700686123E-5 |
| SAOUHSC_02810 | —— | 1.2702352183159 | 5.2073482601813E-5 |
| SAOUHSC_02571 | —— | –1.945540744 | 5.756673238807E-5 |
| SAOUHSC_01456 | —— | 1.2265713029633 | 5.7646377688721E-5 |
| SAOUHSC_03026 | —— | 1.6192805724273 | 5.95938920345E-5 |
| SAOUHSC_01972 | prsA | 1.8721264854143 | 5.9624573462445E-5 |
| SAOUHSC_02127 | sspB2 | –1.73558745 | 5.9910427405557E-5 |
| SAOUHSC_00261 | —— | 1.1087301981543 | 6.1610113595667E-5 |
| SAOUHSC_01105 | sdhB | 0.63499034756244 | 6.9311659309666E-5 |
| SAOUHSC_00232 | lrgA | –2.614325891 | 7.0278278972688E-5 |
| SAOUHSC_01866 | —— | –0.877617073 | 7.2158130724295E-5 |
| SAOUHSC_03033 | hoxN | 1.0308757391713 | 7.9343990195151E-5 |
| SAOUHSC_01130 | —— | 0.88385699375815 | 8.5898121573326E-5 |
| SAOUHSC_00320 | ssuE | 0.99120089272464 | 8.9618503904541E-5 |
| SAOUHSC_02097 | —— | –0.812361393 | 9.3779876664796E-5 |
| SAOUHSC_00142 | —— | –1.03234865 | 0.00011129743304742 |
| SAOUHSC_02620 | —— | 0.98361044823215 | 0.00011129743304742 |
| SAOUHSC_02336 | fabZ | –0.951944525 | 0.00011129743304742 |
| SAOUHSC_02073 | —— | –2.291074176 | 0.00011603334285742 |
| SAOUHSC_01819 | —— | –1.333671402 | 0.00012209325987465 |
| SAOUHSC_00216 | gatC | 1.5902994474867 | 0.00013677090314052 |
| SAOUHSC_00314 | mepR | 1.1901833678051 | 0.00014176143915513 |
| SAOUHSC_00949 | —— | 1.1449240937574 | 0.00014176143915513 |
| SAOUHSC_00199 | pct | 1.4967533394794 | 0.00014330465959289 |
| SAOUHSC_01025 | —— | 1.0186228185275 | 0.00014776274054322 |
| SAOUHSC_01846 | acs | 0.88174122670418 | 0.00018712731236004 |
| SAOUHSC_01485 | ndk | –1.160150773 | 0.00018927929387696 |
| SAOUHSC_02833 | yydJ | 1.4980987051812 | 0.00019146639240666 |
| SAOUHSC_00074 | sirA | –1.230141768 | 0.00020070718467973 |
| SAOUHSC_02759 | —— | –1.394458265 | 0.00020878824435503 |
| SAOUHSC_00424 | metI | 1.5270173935088 | 0.00022008171721972 |
| SAOUHSC_00031 | —— | 1.183440709 | 0.0002235168702752 |
| SAOUHSC_01398 | dapH | 1.1604878163368 | 0.0002251365830159 |
| SAOUHSC_02023 | lytD | –2.562547517 | 0.00024851220349803 |
| SAOUHSC_02025 | —— | –2.663283598 | 0.00026749496898789 |
| SAOUHSC_02915 | —— | 0.83278046772812 | 0.00027106211749688 |
| SAOUHSC_01893 | arsB | 1.1291279713158 | 0.00027106211749688 |
| SAOUHSC_01992 | —— | –1.183044699 | 0.00027495532537467 |
| SAOUHSC_00729 | uup | –0.819946196 | 0.00027747941247022 |
| SAOUHSC_01267 | korB | –0.886010277 | 0.00029345376724633 |
| SAOUHSC_02019 | xlyAB | –2.61948585 | 0.00030865133330252 |
| SAOUHSC_02286 | leuB | 1.513311336 | 0.00030865133330252 |
| SAOUHSC_00628 | mnhD | 0.95461240954379 | 0.00031281649096394 |
| SAOUHSC_02089 | —— | –0.937315036 | 0.00032682378537446 |
| SAOUHSC_02285 | leuA | 1.501022375 | 0.00034432165764077 |
| SAOUHSC_01838 | degP | 0.64469166856785 | 0.00036280601043386 |
| SAOUHSC_00318 | —— | 0.9934244339362 | 0.00036751627576983 |
| SAOUHSC_02254 | groEL | 0.95037100081251 | 0.00037244232291093 |
| SAOUHSC_00828 | lysE | 1.1254889025656 | 0.00037978090514859 |
| SAOUHSC_01232 | rpsB | –0.959729428 | 0.00038224508429394 |
| SAOUHSC_01440 | yhhQ | 0.82802838635069 | 0.00039302042350687 |
| SAOUHSC_00297 | —— | 0.78820504576823 | 0.00040661903501959 |
| SAOUHSC_02886 | —— | –3.854964131 | 0.00040888044575072 |
| SAOUHSC_00125 | —— | 0.80519530464656 | 0.0004361102651382 |
| SAOUHSC_01429 | —— | 2.3834611637476 | 0.00045321715021124 |
| SAOUHSC_02257 | —— | –1.076058704 | 0.00045321715021124 |
| SAOUHSC_02905 | —— | 0.96036437075294 | 0.00045321715021124 |
| SAOUHSC_00195 | fadA | 1.2111347001879 | 0.00049500568389971 |
| SAOUHSC_02261 | agrB | –1.258926529 | 0.00049500568389971 |
| SAOUHSC_00974 | tarM | –1.390951414 | 0.00051173113645252 |
| SAOUHSC_02516 | pbuG | 1.0597660016949 | 0.00053609813097673 |
| SAOUHSC_00814 | —— | –1.981207707 | 0.00055338676970251 |
| SAOUHSC_02022 | —— | –2.484926009 | 0.00055338676970251 |
| SAOUHSC_00730 | recQ | –0.798135 | 0.00055343449483335 |
| SAOUHSC_00702 | —— | 1.0364191168842 | 0.00055714299746504 |
| SAOUHSC_01505 | fmnP | –0.935541971 | 0.00059845072375803 |
| SAOUHSC_00785 | trxB | –0.706118164 | 0.0006026046685049 |
| SAOUHSC_01990 | artR | 0.82560704108829 | 0.00061409787446094 |
| SAOUHSC_00455 | —— | –0.794616589 | 0.00061774284715685 |
| SAOUHSC_00844 | metQ | 0.89249767457257 | 0.00062195511429855 |
| SAOUHSC_02078 | —— | –2.146322363 | 0.00064836444148981 |
| SAOUHSC_02049 | xtmB | –2.162397551 | 0.00065157488808932 |
| SAOUHSC_00067 | lutP | –0.791856518 | 0.00065642735919181 |
| SAOUHSC_02251 | —— | 1.3678068058076 | 0.00067698149717765 |
| SAOUHSC_02644 | —— | 0.82823341915488 | 0.00070638458751913 |
| SAOUHSC_00423 | metN | 1.3310082174506 | 0.00070839469368278 |
| SAOUHSC_01855 | —— | –0.885968198 | 0.00071063650518399 |
| SAOUHSC_00160 | —— | 1.3336340684407 | 0.00072391483770622 |
| SAOUHSC_02035 | —— | –2.490579797 | 0.00072391483770622 |
| SAOUHSC_00400 | —— | –1.210874262 | 0.00074030300702683 |
| SAOUHSC_02255 | groES | 1.2684526792489 | 0.00075293836866132 |
| SAOUHSC_02337 | murA | –0.783002502 | 0.0008276923244114 |
| SAOUHSC_03022 | —— | 0.99472614304331 | 0.00088927058717457 |
| SAOUHSC_00578 | mvaD | 0.90880306548921 | 0.00092303675734698 |
| SAOUHSC_00624 | —— | 1.1508236314742 | 0.00093241120072328 |
| SAOUHSC_00213 | —— | 1.0352366523742 | 0.00094571822843106 |
| SAOUHSC_01728 | —— | 1.0259056697285 | 0.00099011049300636 |
| SAOUHSC_00151 | —— | –0.947777317 | 0.0010183885603033 |
| SAOUHSC_02030 | —— | –2.356931423 | 0.0010363105247461 |
| SAOUHSC_00027 | rlmH | –0.7605509 | 0.0010363105247461 |
| SAOUHSC_00339 | yitJ | 1.4838457489473 | 0.0011216534115456 |
| SAOUHSC_00223 | tarF | –0.705193603 | 0.0011775687918753 |
| SAOUHSC_00408 | —— | 1.1124192449307 | 0.0011989751782817 |
| SAOUHSC_02036 | —— | –2.227302561 | 0.0011989751782817 |
| SAOUHSC_00369 | —— | –0.728111197 | 0.0012263237539811 |
| SAOUHSC_00886 | mnhD | 0.79083619092566 | 0.0012728269294615 |
| SAOUHSC_01399 | —— | 1.0296799605983 | 0.0012728612877591 |
| SAOUHSC_02043 | —— | –2.182326835 | 0.0013005270616331 |
| SAOUHSC_02020 | —— | –2.769710667 | 0.0013310431407999 |
| SAOUHSC_02071 | —— | –1.940700652 | 0.0013310431407999 |
| SAOUHSC_02048 | —— | –1.92678267 | 0.0013310431407999 |
| SAOUHSC_02047 | —— | –1.983902064 | 0.0013310431407999 |
| SAOUHSC_00733 | hisC | 0.89350843037718 | 0.0013714081971918 |
| SAOUHSC_00196 | fadN | 1.5964215649375 | 0.0013789715771421 |
| SAOUHSC_00580 | —— | 0.81341854479336 | 0.0014182347774305 |
| SAOUHSC_01001 | qoxB | 0.89124974347561 | 0.0014394652368104 |
| SAOUHSC_00499 | pdxS | –0.717680471 | 0.0014657235668132 |
| SAOUHSC_00182 | —— | –3.756629236 | 0.0015240693061657 |
| SAOUHSC_02081 | —— | –2.207731237 | 0.0015393310917238 |
| SAOUHSC_01598 | rnz | –0.649636744 | 0.0015497974677063 |
| SAOUHSC_01000 | qoxC | 1.1658000991257 | 0.001559667304985 |
| SAOUHSC_01657 | znuC | –1.328491974 | 0.0015784031631236 |
| SAOUHSC_00571 | —— | 0.9814282242087 | 0.0015822696419789 |
| SAOUHSC_00500 | pdxT | –0.707242277 | 0.0015881801498488 |
| SAOUHSC_02028 | —— | –2.435360545 | 0.0016060287357648 |
| SAOUHSC_01922 | —— | –0.868440006 | 0.0016080947631079 |
| SAOUHSC_01832 | —— | 0.99419765018561 | 0.0016129162977293 |
| SAOUHSC_02080 | —— | –2.219959573 | 0.0016129162977293 |
| SAOUHSC_00613 | —— | –0.693905719 | 0.0016176827995275 |
| SAOUHSC_01719 | —— | –0.846987304 | 0.0017056282022413 |
| SAOUHSC_00004 | recF | –0.682200598 | 0.001724461171991 |
| SAOUHSC_02070 | —— | –1.997130998 | 0.0017318432918364 |
| SAOUHSC_02555 | —— | 1.4527880881133 | 0.0017474662617661 |
| SAOUHSC_02964 | arcR | –0.701552575 | 0.0017521358412912 |
| SAOUHSC_02282 | ilvB | 1.4457241015634 | 0.0017568579152808 |
| SAOUHSC_02029 | —— | –2.294862881 | 0.0018055887254533 |
| SAOUHSC_02031 | —— | –2.292814776 | 0.0018113933129247 |
| SAOUHSC_00859 | —— | –0.846107041 | 0.0018403794525794 |
| SAOUHSC_02284 | ilvC | 1.6351097908128 | 0.0018403794525794 |
| SAOUHSC_02268 | sacA | –0.598153213 | 0.0018598509241493 |
| SAOUHSC_00843 | metI | 1.3197095229335 | 0.0018617483779132 |
| SAOUHSC_02430 | fecB | –0.929366334 | 0.0018634712438434 |
| SAOUHSC_00663 | —— | 0.85410431693891 | 0.0018774604415532 |
| SAOUHSC_01322 | thrB | 1.0576579275055 | 0.0018900565454761 |
| SAOUHSC_02119 | putP | 0.67644246227809 | 0.0019631198368133 |
| SAOUHSC_00265 | —— | 1.3838332054721 | 0.0020381321861999 |
| SAOUHSC_01663 | dnaG | –0.946536206 | 0.0020381321861999 |
| SAOUHSC_01400 | alr | 0.98721079304237 | 0.002044126558964 |
| SAOUHSC_02264 | agrC | –1.355161692 | 0.002044126558964 |
| SAOUHSC_02260 | hld | –3.335088598 | 0.0021252711300557 |
| SAOUHSC_01046 | potA | 0.81193395369185 | 0.0021525144797494 |
| SAOUHSC_02463 | hysA | –0.841416154 | 0.0021543071323346 |
| SAOUHSC_01682 | dnaJ | 0.92568483618151 | 0.0021615477638417 |
| SAOUHSC_01035 | rnj | –0.773108421 | 0.0021615477638417 |
| SAOUHSC_00138 | —— | 1.5231160595332 | 0.0022252539905852 |
| SAOUHSC_00039 | —— | –0.630639631 | 0.0022252539905852 |
| SAOUHSC_01917 | —— | –1.500491516 | 0.0024515058977306 |
| SAOUHSC_01859 | —— | –1.149453262 | 0.0025456565838506 |
| SAOUHSC_01499 | bdr | –0.960643249 | 0.002550162775355 |
| SAOUHSC_02922 | ldh | –1.665222381 | 0.002562934395143 |
| SAOUHSC_00294 | —— | 0.76942425254004 | 0.002562934395143 |
| SAOUHSC_00024 | —— | –0.745554645 | 0.0026833528999581 |
| SAOUHSC_02033 | —— | –2.046530765 | 0.0027001599585945 |
| SAOUHSC_02072 | —— | –1.849055659 | 0.0027396550045291 |
| SAOUHSC_02062 | —— | –2.210724858 | 0.0027715466615032 |
| SAOUHSC_00200 | prsW | –1.011365624 | 0.0028766403979828 |
| SAOUHSC_02782 | —— | –2.557589442 | 0.0028766403979828 |
| SAOUHSC_01774 | hemC | 0.83210745073414 | 0.0028766403979828 |
| SAOUHSC_02050 | xtmA | –1.923274211 | 0.0029142096165542 |
| SAOUHSC_01941 | —— | –1.481904321 | 0.0030366568080707 |
| SAOUHSC_00845 | —— | –1.254532414 | 0.0030366568080707 |
| SAOUHSC_00457 | —— | –0.727909902 | 0.0030749539120972 |
| SAOUHSC_02767 | nikA | –1.014583643 | 0.0031673454336325 |
| SAOUHSC_00925 | oppD | 0.9754212470208 | 0.0031673454336325 |
| SAOUHSC_01746 | secDF | –0.87302987 | 0.0031673454336325 |
| SAOUHSC_00553 | hxlA | –0.735437989 | 0.0031845124834859 |
| SAOUHSC_02426 | —— | 0.96479798418984 | 0.0031845124834859 |
| SAOUHSC_00484 | tilS | –0.693818514 | 0.0031845124834859 |
| SAOUHSC_01798 | —— | –1.097538183 | 0.0032465465112944 |
| SAOUHSC_00407 | —— | 1.5471372735767 | 0.0033337379050762 |
| SAOUHSC_02931 | —— | –1.096339665 | 0.0033803719505524 |
| SAOUHSC_01652 | pbp3 | –0.62449115 | 0.0034284033585014 |
| SAOUHSC_01895 | —— | –1.138044456 | 0.003629313699181 |
| SAOUHSC_00861 | lipA | –0.62499942 | 0.0037173798580694 |
| SAOUHSC_01656 | znuB | –0.727718452 | 0.0037366932486455 |
| SAOUHSC_A02794 | —— | 0.96368518053425 | 0.0037584047329679 |
| SAOUHSC_00410 | —— | –1.037952945 | 0.0038141861824839 |
| SAOUHSC_00987 | sspB | –0.863531735 | 0.0038380367890474 |
| SAOUHSC_02167 | scn | –1.055042585 | 0.0038684082937561 |
| SAOUHSC_00340 | metC | 1.6677678857224 | 0.0039774542636294 |
| SAOUHSC_00257 | —— | 0.8838596507653 | 0.0040196332315527 |
| SAOUHSC_01981 | —— | –0.749060449 | 0.0040311741923895 |
| SAOUHSC_00501 | nupC | –0.620026298 | 0.0040311741923895 |
| SAOUHSC_01680 | rsmE | 0.81953719738372 | 0.004069564111471 |
| SAOUHSC_02881 | crtP | –0.877734969 | 0.0041261638966891 |
| SAOUHSC_01894 | arsC | 0.85126094605531 | 0.0041261638966891 |
| SAOUHSC_02965 | arcC | –0.764711577 | 0.004189512897955 |
| SAOUHSC_02075 | —— | –2.283653054 | 0.0041998958674183 |
| SAOUHSC_02389 | czcD | –0.588514332 | 0.0042853960630795 |
| SAOUHSC_02401 | mtlR | 1.0762846883759 | 0.0043427930864661 |
| SAOUHSC_00304 | —— | –0.79929326 | 0.0045056126596796 |
| SAOUHSC_02041 | —— | –2.326943219 | 0.0045722931019095 |
| SAOUHSC_02682 | cobA | 1.1327999382323 | 0.0045890347259935 |
| SAOUHSC_02802 | fnbB | –0.813815116 | 0.0046346356571564 |
| SAOUHSC_02287 | leuC | 1.1805275833712 | 0.0047602409621069 |
| SAOUHSC_02069 | —— | –1.701743904 | 0.004827043420717 |
| SAOUHSC_00248 | lytM | –1.470348239 | 0.0048326479806063 |
| SAOUHSC_00718 | —— | –1.412442899 | 0.0048594462562751 |
| SAOUHSC_01921 | —— | –1.215843637 | 0.0048594462562751 |
| SAOUHSC_01865 | trmB | –1.630592925 | 0.0049902566700849 |
| SAOUHSC_01470 | dnaD | –1.567635041 | 0.0052454180809356 |
| SAOUHSC_01084 | isdD | –1.966545485 | 0.0053350532686048 |
| SAOUHSC_01369 | trpC | 1.6928905908343 | 0.0053630464442212 |
| SAOUHSC_00420 | —— | –1.415693089 | 0.0053630464442212 |
| SAOUHSC_02865 | feoA | 1.7559958594368 | 0.0054469683750732 |
| SAOUHSC_00459 | rsmI | –0.794590674 | 0.0055866152653913 |
| SAOUHSC_00376 | —— | –0.924995073 | 0.0056737921119313 |
| SAOUHSC_00569 | —— | 0.69437231519019 | 0.006083262961265 |
| SAOUHSC_02034 | —— | –2.324700661 | 0.0063367340686587 |
| SAOUHSC_00533 | hchA | 0.70503375109834 | 0.0064077380393837 |
| SAOUHSC_00198 | fadD | 1.1803825886605 | 0.0064077380393837 |
| SAOUHSC_01984 | —— | –1.982913102 | 0.0065046441664453 |
| SAOUHSC_02912 | phnB | 0.68164726429913 | 0.0066011039307938 |
| SAOUHSC_00485 | hprT | –1.150838863 | 0.0068837621535287 |
| SAOUHSC_00070 | —— | –1.607069379 | 0.0071055466989311 |
| SAOUHSC_02554 | fhuD | –0.736641367 | 0.0071973221617744 |
| SAOUHSC_02038 | —— | –2.349106362 | 0.0073061287363225 |
| SAOUHSC_00398 | hsdS | –0.696762675 | 0.007323999690742 |
| SAOUHSC_02698 | tcyB | 0.65214706899893 | 0.007346472438893 |
| SAOUHSC_03014 | hisG | 1.9561081601111 | 0.0074676373742953 |
| SAOUHSC_00926 | oppF | 0.68348582008041 | 0.0075254879945249 |
| SAOUHSC_01366 | trpE | 1.2214541237489 | 0.0076638388672674 |
| SAOUHSC_01175 | —— | –0.697406285 | 0.0076919872988882 |
| SAOUHSC_01283 | hflX | –0.738717799 | 0.0078071523761841 |
| SAOUHSC_00135 | —— | 1.1205897705145 | 0.0078823483432322 |
| SAOUHSC_00146 | yagU | 1.1533711067711 | 0.0079027308860409 |
| SAOUHSC_00732 | opuC | –0.973904126 | 0.0080063639001598 |
| SAOUHSC_02821 | —— | –2.828766572 | 0.0080986291482735 |
| SAOUHSC_01367 | trpG | 1.5354408521836 | 0.008117058634152 |
| SAOUHSC_01845 | fhs | –0.772489049 | 0.0082631114308812 |
| SAOUHSC_00955 | —— | 1.4763563077387 | 0.0082728303808098 |
| SAOUHSC_01932 | hsdS | –0.697050329 | 0.0084541206854359 |
| SAOUHSC_00126 | wbqP | 0.89114922274564 | 0.0086385737562355 |
| SAOUHSC_00264 | —— | 1.424808308 | 0.0088853875171341 |
| SAOUHSC_01224 | xerC | 0.59970467223051 | 0.0090025383243678 |
| SAOUHSC_02628 | —— | 0.64676182628661 | 0.0090248145149327 |
| SAOUHSC_02252 | —— | 1.3356005947543 | 0.0092842399575819 |
| SAOUHSC_01050 | —— | 0.62603057169822 | 0.0093099456940017 |
| SAOUHSC_01371 | trpB | 1.1339514851537 | 0.0093685466680958 |
| SAOUHSC_02722 | —— | 1.265829721 | 0.0095152780461692 |
| SAOUHSC_01919 | —— | 0.61070577489993 | 0.0098845449764311 |
| SAOUHSC_00426 | metQ | 0.8558507016274 | 0.010254345434558 |
| SAOUHSC_01378 | ddpD | 0.78149670235145 | 0.010409358824149 |
| SAOUHSC_01310 | clsA_B | –0.623310589 | 0.01048920636864 |
| SAOUHSC_02737 | —— | –1.13184977 | 0.010539784921183 |
| SAOUHSC_00123 | —— | 0.77501562540692 | 0.010803160178168 |
| SAOUHSC_01053 | mntH | –0.887165069 | 0.010889907675584 |
| SAOUHSC_02150 | —— | 0.99918684271384 | 0.01101101896572 |
| SAOUHSC_00556 | proP | 0.84117395986832 | 0.011092657693992 |
| SAOUHSC_02504 | rpmC | 0.94708993883567 | 0.011187758468841 |
| SAOUHSC_02040 | —— | –2.321366434 | 0.011288668581717 |
| SAOUHSC_01732 | cymR | 1.2533941006336 | 0.011519449852535 |
| SAOUHSC_00127 | —— | 0.68375810802788 | 0.012327475090331 |
| SAOUHSC_02794 | —— | 0.75190662116386 | 0.012341931223729 |
| SAOUHSC_00999 | qoxD | 1.1930475306718 | 0.012359786531489 |
| SAOUHSC_02936 | —— | 1.0475020572553 | 0.012433092480013 |
| SAOUHSC_00483 | —— | –0.772856565 | 0.01266315317218 |
| SAOUHSC_00982 | menF | –0.799557985 | 0.012675224239772 |
| SAOUHSC_01858 | —— | –0.716376348 | 0.012735487710396 |
| SAOUHSC_00997 | tagT_U_V | 0.68040835548184 | 0.012735487710396 |
| SAOUHSC_02074 | —— | –1.891819522 | 0.012780146088771 |
| SAOUHSC_02643 | —— | 0.84524214995516 | 0.012963791573159 |
| SAOUHSC_01761 | —— | 1.4964487780231 | 0.013286910452217 |
| SAOUHSC_02641 | hrtB | –1.130792022 | 0.013475013885289 |
| SAOUHSC_02314 | kdpD | –0.594283985 | 0.013739135932453 |
| SAOUHSC_00164 | —— | –0.890156944 | 0.013788567117111 |
| SAOUHSC_01015 | purM | 1.0815961773857 | 0.013788567117111 |
| SAOUHSC_02256 | —— | –2.151048217 | 0.013821414494208 |
| SAOUHSC_02296 | sprL | 0.71377266195296 | 0.014038242335137 |
| SAOUHSC_00842 | metN | 0.92683686075629 | 0.014460625269325 |
| SAOUHSC_02021 | —— | –1.904773969 | 0.014549261665069 |
| SAOUHSC_02281 | ilvD | 1.0055275009112 | 0.014549261665069 |
| SAOUHSC_01278 | glpA | 0.98839899356746 | 0.014549261665069 |
| SAOUHSC_02003 | —— | –0.740692206 | 0.014606782052667 |
| SAOUHSC_02989 | secY | 1.1019515149419 | 0.015002300471635 |
| SAOUHSC_02037 | —— | –2.121411367 | 0.015057438140545 |
| SAOUHSC_00051 | plc | –1.484159155 | 0.015117706397277 |
| SAOUHSC_02250 | xtmA | 1.0549842676443 | 0.015117706397277 |
| SAOUHSC_01827 | ezrA | –0.792305537 | 0.015273721628814 |
| SAOUHSC_02067 | —— | –1.466351222 | 0.015273721628814 |
| SAOUHSC_03012 | hisC | 1.2634632350601 | 0.015332995542907 |
| SAOUHSC_00903 | lepB | 0.9085317826467 | 0.015576064851856 |
| SAOUHSC_01835 | —— | 0.71274962729167 | 0.015635846608348 |
| SAOUHSC_02160 | —— | –1.011817438 | 0.015840551620092 |
| SAOUHSC_00367 | —— | 0.63697018634498 | 0.016264326636488 |
| SAOUHSC_00927 | oppA | 0.61716862515199 | 0.016301546314128 |
| SAOUHSC_02374 | —— | 0.65140153445938 | 0.016498147277992 |
| SAOUHSC_00397 | hsdM | –0.79702771 | 0.016987855676016 |
| SAOUHSC_02216 | dnaC | –1.726556635 | 0.017395169967262 |
| SAOUHSC_00153 | kdcA | –1.157685425 | 0.017395169967262 |
| SAOUHSC_01014 | purF | 0.97463902594955 | 0.017409635013242 |
| SAOUHSC_00687 | —— | –0.823880584 | 0.017651902805897 |
| SAOUHSC_00513 | rlmB | –0.615721981 | 0.017891366253773 |
| SAOUHSC_01957 | —— | –1.556731757 | 0.01902924322533 |
| SAOUHSC_03015 | —— | 1.3060472051336 | 0.019161155465064 |
| SAOUHSC_02077 | —— | –1.884389844 | 0.019326026892599 |
| SAOUHSC_00755 | brxC | 0.8801040197605 | 0.019326026892599 |
| SAOUHSC_02648 | lutP | 0.76254027567171 | 0.019674973505926 |
| SAOUHSC_00206 | ldh | 1.1975153267858 | 0.01991387184268 |
| SAOUHSC_00627 | mnhC | 1.5576152766463 | 0.020325803408133 |
| SAOUHSC_02656 | —— | 0.70680789873821 | 0.02046863452966 |
| SAOUHSC_01912 | —— | –0.618565035 | 0.020845223359725 |
| SAOUHSC_00973 | tarM | –1.590034613 | 0.02087454656448 |
| SAOUHSC_02044 | —— | –1.808871444 | 0.021124015792806 |
| SAOUHSC_00983 | menD | –0.592091051 | 0.021624064223988 |
| SAOUHSC_02489 | infA | 1.9217058568979 | 0.021738210119006 |
| SAOUHSC_02499 | rpsN | 0.99698041857665 | 0.022331103243729 |
| SAOUHSC_01980 | —— | –0.881628291 | 0.022604035630873 |
| SAOUHSC_00907 | —— | –0.792386068 | 0.022604035630873 |
| SAOUHSC_00924 | oppC | 0.67039310721848 | 0.022677695863217 |
| SAOUHSC_00139 | —— | 0.789152165 | 0.022976941182604 |
| SAOUHSC_00306 | —— | –0.758852116 | 0.023101924935431 |
| SAOUHSC_00281 | —— | 0.72836030017228 | 0.023201857398939 |
| SAOUHSC_00230 | lytS | –0.741426501 | 0.023309334594991 |
| SAOUHSC_00543 | —— | –0.794437393 | 0.024012485713891 |
| SAOUHSC_00430 | —— | –0.590903598 | 0.024029065465179 |
| SAOUHSC_02935 | gbsR | 0.59242691239871 | 0.024055687406333 |
| SAOUHSC_00189 | —— | 1.9486005743027 | 0.025009191984528 |
| SAOUHSC_02556 | —— | 0.97092453348568 | 0.025109334074636 |
| SAOUHSC_00002 | dnaN | –0.706122393 | 0.025581360055176 |
| SAOUHSC_01833 | serA | 0.64560442399349 | 0.02592724734116 |
| SAOUHSC_00795 | gapA | –0.860763869 | 0.026913773607212 |
| SAOUHSC_02930 | —— | –0.728785976 | 0.026931312769316 |
| SAOUHSC_00158 | scrA | 0.7374016350904 | 0.026931312769316 |
| SAOUHSC_00115 | epsB | 0.72909256651998 | 0.027912832989699 |
| SAOUHSC_03017 | —— | 1.2217915847835 | 0.027915035396921 |
| SAOUHSC_00055 | —— | 0.72773078066525 | 0.02826304212412 |
| SAOUHSC_00952 | —— | 0.71283337431475 | 0.028712449099309 |
| SAOUHSC_02288 | leuD | 1.2731404263906 | 0.028777724463393 |
| SAOUHSC_03006 | lip | –0.615814407 | 0.02925237542845 |
| SAOUHSC_02425 | —— | 0.60172615227374 | 0.02925237542845 |
| SAOUHSC_01839 | tyrS | –0.596161345 | 0.029415271688784 |
| SAOUHSC_01814 | —— | –0.984055167 | 0.029614605992862 |
| SAOUHSC_02949 | gpx | 0.73178886028305 | 0.029614605992862 |
| SAOUHSC_02761 | —— | –1.746345784 | 0.029702948062902 |
| SAOUHSC_02169 | chp | –0.905097223 | 0.02981912268268 |
| SAOUHSC_01327 | katE | 0.70134744937135 | 0.029923714909207 |
| SAOUHSC_02027 | —— | –2.072481539 | 0.029923714909207 |
| SAOUHSC_00487 | hslO | –0.81672176 | 0.030896756398121 |
| SAOUHSC_00245 | —— | 0.73658650340847 | 0.030896756398121 |
| SAOUHSC_00504 | mcsB | 0.6751025630853 | 0.030896756398121 |
| SAOUHSC_01368 | trpD | 1.0338372042269 | 0.031573521532115 |
| SAOUHSC_00953 | ugtP | 0.71385871496396 | 0.031845479771168 |
| SAOUHSC_02225 | —— | –1.50044378 | 0.032390188542466 |
| SAOUHSC_02171 | sak | –0.967395266 | 0.032767791734373 |
| SAOUHSC_01049 | potD | 0.62999276461192 | 0.032812214338401 |
| SAOUHSC_00013 | metX | 0.76822053993132 | 0.033585449334365 |
| SAOUHSC_01655 | zurR | –2.121269244 | 0.034366458989059 |
| SAOUHSC_00962 | —— | 1.1788745705911 | 0.034486406603441 |
| SAOUHSC_01112 | flr | –1.128399296 | 0.034753022391816 |
| SAOUHSC_01030 | —— | –3.315677473 | 0.03530375301796 |
| SAOUHSC_03018 | ecfT | 1.2301526827511 | 0.035309868251534 |
| SAOUHSC_00565 | —— | 0.79570315401162 | 0.036119645577722 |
| SAOUHSC_02597 | glvC | 0.60439264048226 | 0.036119645577722 |
| SAOUHSC_00317 | glpT | 0.62705245136464 | 0.036123920498249 |
| SAOUHSC_00007 | nnrD | –0.620154003 | 0.036123920498249 |
| SAOUHSC_01689 | rpsT | –0.596296243 | 0.036267171055774 |
| SAOUHSC_01370 | trpF | 1.4328471159455 | 0.036599122535287 |
| SAOUHSC_03008 | hisF | 0.90915417541718 | 0.037030167846077 |
| SAOUHSC_00121 | catB | 0.95558860403907 | 0.037066859416276 |
| SAOUHSC_01991 | artQ | 0.77995239682822 | 0.037375544138949 |
| SAOUHSC_02880 | crtQ | –0.62193226 | 0.037422657824837 |
| SAOUHSC_01316 | nuc | –0.622076177 | 0.0374778259104 |
| SAOUHSC_01326 | —— | 0.61158440319035 | 0.03761562572263 |
| SAOUHSC_02280 | tsaE | –0.993900481 | 0.03761562572263 |
| SAOUHSC_01944 | —— | –0.824111209 | 0.038274569951526 |
| SAOUHSC_02233 | —— | –1.342269012 | 0.038305833198003 |
| SAOUHSC_03013 | hisD | 1.05471473 | 0.039068880547926 |
| SAOUHSC_00258 | —— | 0.59213349092584 | 0.040505359422045 |
| SAOUHSC_00335 | —— | 0.88371466333511 | 0.040587226037438 |
| SAOUHSC_02057 | dut | –1.397278465 | 0.041087980967276 |
| SAOUHSC_02064 | —— | –1.648190976 | 0.041443935436531 |
| SAOUHSC_00188 | pflA | 1.0346411558535 | 0.041443935436531 |
| SAOUHSC_00344 | ybiO | 0.622289308 | 0.041576445439207 |
| SAOUHSC_00429 | —— | –0.670332087 | 0.042152511866308 |
| SAOUHSC_02766 | nikB | –0.766028991 | 0.042331534923952 |
| SAOUHSC_01717 | prtC | –0.731843791 | 0.042331534923952 |
| SAOUHSC_02087 | —— | –0.793254499 | 0.042740960187708 |
| SAOUHSC_01162 | lspA | –1.721825481 | 0.042758572993453 |
| SAOUHSC_01082 | isdC | –0.886822112 | 0.043260661780056 |
| SAOUHSC_00163 | —— | –1.215351425 | 0.044251351000612 |
| SAOUHSC_00708 | fruA | 0.81818010955068 | 0.044382425323806 |
| SAOUHSC_01466 | recU | 0.76893983205376 | 0.044605113483786 |
| SAOUHSC_02670 | —— | 0.72924224432836 | 0.044605113483786 |
| SAOUHSC_01756 | ysxB | 1.3453351983125 | 0.044605113483786 |
| SAOUHSC_01125 | —— | –0.959254275 | 0.04706066569654 |
| SAOUHSC_02051 | —— | –1.360318048 | 0.047100266010791 |
| SAOUHSC_00299 | —— | 1.3552536186881 | 0.04734831813698 |
| SAOUHSC_00219 | gutB | 0.72316706270734 | 0.047423957542919 |
| SAOUHSC_02016 | —— | 0.65780685310957 | 0.048108954512002 |
| SAOUHSC_00923 | oppB | 0.59064755906276 | 0.048897915770427 |